Detailed Information [141923]
 

Strain Information
DGRC Number 141923
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL06846 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL06846 bw1 / CyO, S* bw1
Break points/Insertion Site 52A13
Related Genes CG30466 (CG30466), Cdk5 (CG8203)
Received Date 11 December 2008
Original Number LL06846
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:11459511(+)
Cytological Band: 52A13
Gene Symbol-1: CG30466
CG Number-1: CG30466
FlyBase ID-1: FBgn0050466
Insertion Type-1: CDS
Gene Symbol-2: Cdk5
CG Number-2: CG8203
FlyBase ID-2: FBgn0013762
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 11459511
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAACTTAAACGATGCGGACGTGCCAAGAATGTTGA
AAACTTTTCCAAATCTGACAACTTTTAGCCCCCATGGAAAGTTTACTGGCAAACACTTTG
ATGAATTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE