Detailed Information [141978]
 

Strain Information
DGRC Number 141978
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL07165 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL07165 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 88F4
Related Genes Atx2 (CG5166)
Received Date 11 December 2008
Original Number LL07165
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:11235305(+)
Cytological Band: 88F4
Gene Symbol-1: Atx2
CG Number-1: CG5166
FlyBase ID-1: FBgn0041188
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 11235305
Chromosome Band 3R
Flanking Sequence
tttacgcagactatctttctagggTTAATCTCGTGAATGCTACCTACTACTGCAGCATCT
CATGGAAAACCATTCTTAAGCTTTTTTTTTGTTGGTTTTTTGGAATGCAAATGGCGCTTA
TATAATAGGCCATCGCGAGCCCTGTGTGTCTGTGTGTGCGAGTGAGTGCAAGCATGTGTG
TGTGTGTGTGTTTGTGTTTCAAGAATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE