Detailed Information [142110]
 

Strain Information
DGRC Number 142110
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL07687 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL07687 bw1 / CyO, S* bw1
Break points/Insertion Site 55E2
Related Genes mRpS28 (CG5497), CG5323 (CG5323)
Received Date 11 December 2008
Original Number LL07687
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:14502156(-)
Cytological Band: 55E2
Gene Symbol-1: mRpS28
CG Number-1: CG5497
FlyBase ID-1: FBgn0034361
Insertion Type-1: Intron
Gene Symbol-2: CG5323
CG Number-2: CG5323
FlyBase ID-2: FBgn0034362
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2026-09-16
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 14502156
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggTTAAGTAATCCCATTGTTTATGTAATAACTTGTTGA
TTTCTGGAGCAGCTGGGCAACGCCGAGGGCAAGGTGGTCAGTGGCAAGATCTTTCATGTG
GTGGGCGATGATCTCTACATAGACTTTGGTTGGAAGTTCCACTGCGTCTGCAGTCGTCCA
ACACGCAATGCCAGGTGAGTTCAATATAATTTCCTGTCTCTTTATCCAATAAACCACTTT
TCCTACTTCAGCGACTATGTGCGAGGAGCCCGTGTTCGAAttaaccattgtgggaacact
agaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE