Detailed Information [142193]
 

Strain Information
DGRC Number 142193
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL08097 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL08097 bw1 / CyO, S* bw1
Break points/Insertion Site 57B16
Related Genes CG10527 (CG10527), CG10531 (CG10531)
Received Date 11 December 2008
Original Number LL08097
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:16957665(+)
Cytological Band: 57B16
Gene Symbol-1: CG10527
CG Number-1: CG10527
FlyBase ID-1: FBgn0034583
Insertion Type-1: 3' UTR
Gene Symbol-2: CG10531
CG Number-2: CG10531
FlyBase ID-2: FBgn0034582
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 16957665
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAAAAAAAAGAATGTTTGATACTAATTTCATTGA
GTACAAATGGATTAAAAGGTGATTAATGATTGCGATAGAACTGTTAGATTCACTAAAACC
AAAATCCAACTAATCTTAACACACCACTTTTTTGAAAAATTAAAGCAGCTATTCAGCTTA
TTTTATATTTATTTCCAAGCTTAATGAATGCAAATAAGTGCCTATTTCAGATATGTTATT
TTCTTAAACATATTTATTGTTTATTAACCAATTTCGTTGAACAATGTAATAAACTTTTCG
AAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE