Detailed Information [142218]
 

Strain Information
DGRC Number 142218
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E PBac{SAstopDsRed}LL08213 / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E PBac{SAstopDsRed}LL08213 / TM6B, Tb1
Break points/Insertion Site 99B10
Related Genes CG7609 (CG7609), CG1972 (CG1972)
Received Date 11 December 2008
Original Number LL08213
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:25570542(-)
Cytological Band: 99B10
Gene Symbol-1: CG7609
CG Number-1: CG7609
FlyBase ID-1: FBgn0027518
Insertion Type-1: CDS
Gene Symbol-2: CG1972
CG Number-2: CG1972
FlyBase ID-2: FBgn0039691
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2021-09-08
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 25570542
Chromosome Band 3R
Flanking Sequence 
tttacgcacactatctttctagggTTAAGGTGTACTCCATAAACAGCAATGGCTTCACGG
AATCGTGTAATATGCGCGGAAAGAACCAGAATCTTAGCTACTCCGCCAACGATGTGGCCT
GGTCCACTTTGGATAGCAATCTTTTGGCTACGGCGGCCACGAACGGAGTGGTTTCCGTGT
GGGATCTCTCCAAGTTCGGCAGGCAGAAGCAGCTGCTTGTCTACAACGAACATGAGCGCA
CCGCCCACACCGTGACCTTCCACAGCAGCGAGCCCAACATCCTGATCTCCGGTTCTCAGG
ATGGCACCATCAAGTGTTTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE