Detailed Information [200074]
Strain Information
DGRC Number 200074
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV1}GS1046 / Binsinscy
Genotype y1 w67c23 P{w+mC=GSV1}GS1046 / Binsinscy
Break points/Insertion Site 7E3
Map Viewer
Received Date 1/28/03
Original Number 1046
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV1
Location (tagged genes):
Function / Process (tagged genes):
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]		 Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV1
Insertion Point 8255890 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
GTGTGCAAAATCCAAAAGATTCTACAATCCGAATCGAAAACAAAAACATAAGAACCACAA
AAGCAGCAGCAGAAAGAGACACAGAGAGCAGCGAAAACTTAACTGCGAATTCAGCGGCTG
AAGCAAAGCAGCGGAGCCCAAGTGCAAGCGAGACGGCAGCAGAGCTCCGCTGCAAGGCAA
CGGGATAGAAAGAGAGATAAATAGAGAGACAGCGCAGCAGCGATATAGAGTGAGAGCAGG
CGGGAGAGCGAGTAG
Sequence Comment X:8255591..8255890dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV1
Insertion Point 8255890 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
GGGAGAGCTAGACGACGACCTACTACACAAAAAAAGGTGATAATTTTTTCATTTCATTCT
TTTTACCTTTTGATTTTTCTTTCTTTACCCCCTTCGAATTTCGTTTTAGTTGTATTTTGT
GGTATCTATAGTTAACACATCTTGTACGCCTAGTCTAGTTTTAAGTGAAAATCGTACGAA
TCGTACGTACCAAGAAATGCCAAAGCAAATAATGTAACTTGCTCTCTCTCTCCCTCGCAC
ACTTCCTCTAGCTCTCGCTCTCATTTCATAACTCGTTTTCCATAAATTTCATATATATTT
Sequence Comment X:8255890..8256189dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE