Detailed Information [204134]

Strain Information
DGRC Number 204134
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV7}GS22570 / Binsinscy
Genotype y1 w67c23 P{w+mC=GSV7}GS22570 / Binsinscy
Break points/Insertion Site 012F04
Map Viewer
Received Date 2007
Original Number 22570
Chromosome X
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 14617990
Vector: GSV7
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2017-12-27
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV7
Insertion Point 14617990 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 012F04
Flanking Sequence
AGGCGGCATTGTGATTGGAATCGTAGCCACCGGCAATGTAGTTCCTCTTGTCGTTGTGCG
AGTGGACAAAGACCCACTTGTAGTCATCGTTGATGTCGATCAGCTCGGCATCGCCGGGAC
AGCTACTGTCCCACCAGTTGCTATGCCCACAGGCGATGTGGGAGCCACCGTTGCAGATGT
CCGACGAACAATAGTCGGTGGCCTGGGCCAGGGCCAAGGAAACGATCAGGATGGCAAGCA
GAGCGAGTTTCATAT
Sequence Comment X:14617691..14617990dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV7
Insertion Point 14617990 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 012F04
Flanking Sequence
TCGTCTGGCAATGTGTTTATAAGGGGCTGATTGGAGCATTGTTGATTGGAAGAAATTAAT
CGAGTGCAAATATAAATCATTCCAATGGCCTAATCTAATCGCCACTCCTATATTTACGAC
GGACTAACTCTTGGTGTATTTAGTTCTGGGAACTAACTATATAGATGTGGGAAATGAAAG
AAATAAAATATATGTATTTTGTACATATTCAATCCATATTCAGTCCATTCAAGTTAACTA
AATATATGTACATAGATCTGAATTCACAGAAAAATAGTTCTCTAAGCCATAAATTCCTAT
Sequence Comment X:14617990..14618289dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE