Detailed Information [206736]

Strain Information
DGRC Number 206736
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS16717 / SM1
Genotype y1 w67c23; P{w+mC=GSV6}GS16717 / SM1
Break points/Insertion Site 032F02
Map Viewer
Received Date 1 Februay 2007
Original Number 16717
Chromosome 2L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 11516831
Vector: GSV6
General Information GS_lines
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Last update 2017-11-21
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 11516831 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 032F02
Flanking Sequence
CGGGCAAAACAAGTTGGCCGAATGAAAGAGAAGAAAAGCTGGCGAACACACAATGGTGGA
AAGCACTGCGAGTTATATAAACCCTTTTTTTCCTTGATTGGAGTTTATCTTGGCCCAGCA
GCACGCCTATTTGTCCAAAAAATAGGAAAATATAGCGTATTTTCCTTTACATCGAAAATC
TTATTACGCACACTCACACACACGCACGCGAACGCAACAGCTGAATGGGCGCGCGAAAGA
GAGGGGACGAGCTCC
Sequence Comment 2L:11516532..11516831dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 11516831 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 032F02
Flanking Sequence
GGCGGACGTTGAACGGGACAACCGACGACTTTTACCGTTTTCGCTCGCGCATCCGGATTC
CGGAAGTTGAGTTTCTTGGATCGTTGGGCGAAAAGTCAACCTCTACGGTGCACGACACTC
TTGGAAGAACACTGCGACGAAAGCGATGACGAATGGCCAACGAAAATTGAACGAAATGAA
ATAAAAAAAAACAACACAACTTCTTCACTAAAACGTCACCAGTGTGACCGCGGAGTGACC
GATAAATAATACACTCTGTCTCTTTAGACAATATTAAAATCGATAGTATTGTTTAATATC
Sequence Comment 2L:11516831..11517130dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE