Detailed Information [207008]
Strain Information
DGRC Number 207008
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV2}GS50433 / FM7c
y1 w67c23 P{w+mC=GSV2}GS50433 / FM7c
Break points/Insertion Site 018C01
Map Viewer
Received Date 2007
Original Number 50433
Chromosome X
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 19132301
Vector: GSV2
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2019-04-18
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 19132301 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 018C01
Flanking Sequence
GTCTTGCTCGCTCTCTCGTCGCGTCTCTTCCTTCCTCGATTTCGATGAGCTACGCGCGGC
TGTTCAATCGATACTGAATACTGAACACTGACTGCCGTCGCCGTTTGCCGTCCCGTCGCT
GCCGCTGTCTCAGTCGCCGTTACCGTCGTCGCACAGTGGGCCAAATTAATTGGTTAACTA
GCTAGCAATGGGTATTGGTGATCCAGATTTCTAGAACTTTTGATCACACTTTTGTAAAGA
ACGCGAAAAATTAGA
Sequence Comment X:19132002..19132301dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 19132301 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 018C01
Flanking Sequence
ACTATCGGTTTTTTGATACTAGATATATTTAGCCTGCCGATCTCTTACTAAACAATGAAA
ATCGGAACTGGTTCAAATGAAATTGGAGTAGAGTGGTTACATTTGGGCCCACTGTGCCAC
AGTGTCGTTTCATTCAGAGAGAGTCCCCATGTCCATGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTCGGTGTTGCAGTATTTCAAGATCGCGTTCTAATG
CCGATCGAAAGAGAAATAAAACGTGGAGTGAGAGAAGTCGCTTACTTCGCTTGCCAAAAT
Sequence Comment X:19132301..19132600dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE