Detailed Information [104140]

Strain Information
DGRC Number 104140
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}sgg[NP2253] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}sggNP2253 w* / FM7c
Break points/Insertion Site 3A8
Map Viewer
Related Genes EG:BACR7C10.2 sgg
Original Number 2253
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2253

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 82
General Information NP_lines
Embryonic Expression scattered cells
Larval GFP epi stripe, tr node.
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hartman TR, Ventresca EM, Hopkins A, Zinshteyn D, Singh T, O'Brien JA, Neubert BC, Hartman MG, Schofield HK, Stavrides KP, Talbot DE, Riggs DJ, Pritchard C, O'Reilly AM.
Novel tools for genetic manipulation of follicle stem cells in the Drosophila ovary reveal an integrin-dependent transition from quiescence to proliferation.
Genetics (2015) 199(4) 935-57 [PubMed ID = 25680813] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22245_0807
Strand Plus
Insertion Point 2399391
Chromosome Band X
Flanking Sequence
ANNTNCGTNTNGGAAAAAAACCAACTTTTTTGGGNCNNNCGGAAAGCCTCGGCTATCGAC
GGGAACCACCTTTTNTTATTTCATCATGGTCCAAGTATTCGTATTCGTATTCGCCGNCGC
CGCTCTCTCGCCTGCCGCATTATCGCTGCGCTCGACTTTTGCGCTGNAATGCAAGACTGC
TGAAANGCTGTTGAATGGCGCCTTTNTGCTCGGATGCCGNAGCGAAAACTTTNNATGNNN
AGNACCACGAAATTCGNGGCGAGAAGAACGCTGAAATNGAAAAAACGCGCGCCACAAATG
AAAGGGNAAAGNGGNAAACAATGNGAGNNAAACCTGNNGAATNANGNCNATNNNAACACA
CTNACTGCAGANNGTGNCCCCCNANTNAACTGGCGCTGGNGGGAGTGGAGGGGGANTNGG
GATGCACTCCNCTCNGTNNNCCNCNACTCTGCTNTCNTNTCNNCNCTACATCTGNNGGTN
CCGGGGGNGGGGGCNNANNGGNCNGNGCGGNAAAAACGNTTNNTGNNNCCGCTGGNNNNC
NGNNNNACNTANCCGNGNNCNANACNAACTNNNNTCNGNNTNNNTCNNNNGNNNTNCCTC
NTTTTTNTTNNGTTTTATTTTTATACCTNCNTTNTCNTTANNTCTNTCTAAGGTTTATNT
NTCCTNNAGTNTNTGCCNGGTTNNNNGGTTNTCNNCNTATTNTNTCTCCNNCGGGCGNTT
NTTTCNCCNNNGNCACCTCCCNTTNNNTACCTCNCCGTNCNCGNCCCGNTTNCGANANCC
NCNCNGTTNATTCCCTNCCCctntcaccgttnnncncnacnttctnncntccnnaaccnn
ntccatnnantntnanattnccccctccttctacnnnntcctcannctntctncccnnct
ncccngtttnttttntntcgngntaccagttacttcncttnccncnnntctnanccaacc
ngntaccctnctanncttttttgccgccacngattaccgngtntacncnaanaancgcnt
ncacacnccnaattctnncccnngctccnnngtngannatcacaatanaaaanaaaaat

Library Name / Clone Name np / np59663_0309
Strand Minus
Insertion Point 2399487
Chromosome Band X
Flanking Sequence
ntcgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggaccaccttat
gttatttcatcatgACTTGGCACNTATTNATNGATTGACTGGGGCAAAGAAGAAGAGCAC
AAGAGAGCGGCAGAGTAAATGAGTGAACGGAGAGACAGAGAGAGAGAGAGAGAATATTCT
GCTAAGCAGTCGCTGTTAAGAATTAAGCTTTTAACATTTAACACAGGTGGTAGCAGAAGC
GTTGAAAAGGGGCGGGTGGGGTAAGCACTGATAATACGATGGCATTTTTCGCGTATCGAG
GGCTAAAAACAGCCGTGTGCCCAAAACAGCTGAGTAATAAAATTCAATTACTCAAGAACA
CAAAATCTAACAAATAAAGCAGCAACTCAATTAACGTTTAATTTCACTTTACAGCAACTG
GTCGCCAAATTAATTTGCTGAAATAAACATCTTGGCTTTTTTTTTTTTTTTNNNCCNAAN
NTTTTANNTTNGGGGGGGGGNAAAAAAAANCCNCCAAANAAANTTNNTTTTTNCNNNNCC
CCNTTTNCCCCNTTNNNNTNCCNAANGGGGNNGGNNNNTTTTTTTNCCCCGGGGTCCCNN
NCNNNCNTTTTTNNTTANNCCNGGAAANTTNTTNNANGGGTTTTCCCCCCCTTTNAAANC
NTNNGGNTTTTNNNAANGGNCCCTTTCTGNCCCCNTTTNNCNCCNNNNNNNNNNNNNNNC
CNNNNCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE