Detailed Information [104564]

Strain Information
DGRC Number 104564
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP4002 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP4002 / FM7c
Break points/Insertion Site 14A8; -; 14A9
Map Viewer
Related Genes CG8958 CG9216
Original Number 4002
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4002

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 381
General Information NP_lines
Embryonic Expression a small # of cells (TU)
Larval GFP gut, pns
Larval X-gal mt, ch
Adult GFP ant S3, tarsal 1, 2. strong bodywall.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11175_0727
Flanking Sequence
cttcttggggtnaaaagcctttttttgngtacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGCTCGGCCCTTGCTAAGTGGCGTGTGCTACAATTAAGT
AACGGGCAGAGACATTTCACAACAACAACAAAAAATAGGAAAATAGAATACAACAAGAAA
TACAAAACCAAAAACCATCAAAATCCCAATAAAACCAANNNTTTTTAAACAAGAAAATAA
TAAATAGACATCCGAGCACATATACCCACGCAAAAGTAAAACAATAGCATACTAGTTCGT
ACAACTAGGGTATTTTATACATAACTCGCTAAATCCTTCGTTTAATACAACGACCACCAG
GAGGAAACAACCAAAAACTACAGTAAATCGGGAACAAGAAATAACCCATCAGCAACTGCA
CCCGGTACTTAAAAAAAAAAANAAATAAANGGTTAATTACAATTTTTTNTTTTTTTTGNT
ANAAAAAAANGCAAANNTTTGGGGACTTGGGGGGGCCTGGGCAAAAATTGGNAAAGNCGG
GAACTTTNCCCCCNTNNNNANANATTTTTTTNGCCCCCCNANGAAAANNCCANAACAATG
GTTGGGGTTTTAAAAAAAAAAAGGANCGNAAAAAAAAAAACNAAANGGGGGGGGGGGGGN
NGGTTTTTTTNATTTTTGGGGGGGGGGNTNNNANACTTTTGGTTTGGGGNCCCNTATTTT
NGGGGNCCCATNAAANACGNGGGTTTTTTAAACCCCNAAAGGGAAANTTTTTTTTTAAAA
AATTGGGGGGGAGAGAGGGTtctttccgggaaaaaaaanaaaccccctttttaggaaaaa
aaatttgggggnaaaaaaanaannaacccccgggggggccaaanttgaacccccagnttt
tnagggggggcctttggggggngggcccaaaattaaaanttttgggattggttgnaaaaa
anttgggggaaaaaaacng

Library Name / Clone Name np / np28535_0807
Strand Minus
Insertion Point 15822506
Chromosome Band X
Flanking Sequence
atcttgggggaaaaagccttttttgtgtacttcggnaagcntcggctatcgacgggacca
ccttatgttatttcatcatgGCTCGGCCCTTGCTAAGTGGCGTGTGCTACAATTAAGTAA
CGGGCAGAGACATTTCACAACAACAACAAAAAATAGGAAAATAGAATACAACAAGAAATA
CAAAACCAAAAACCATCAAAATCCCAATAAAACCAAACCNTTTTAAACAAGAAAATAATA
AATAGACATCCGAGCACATATACCCACGCAAAAGTAAAACAATAGCATACTAGTTCGTAC
AACTAGGGTATTTTATACATAACTCGCTAAATCCTTCGTTTAATACAACGACCACCAGGA
GGAAACAACCAAAAACTACAGTAAATCGGAAACAAGAAATAACCATCAGCAAACTGCACC
GGTACTTAAAAAAAAAAACAAATAAANGTTTAATTNCAATTTTTTATNTNTTTTGTTANA
AAAAAANGCAATATATTNGGGTNCTTGGGGGGGCTGGGCAAAAATTGAGAAAGCAGNGAA
CTATCCCCCACTACACATACATTTATNTAGCCCCCACAGAAAATACAATAACAATGATTG
NGGTTTAAAAAAAAAAAGGAACCGAAAAAAAAAAANNAAAANGGGGGNGGGGGNGNGGTT
TTTTTAATTTTNGGGGGGGNGTTTAAATCNTTTTTNTTTTTTGGCCCCTNTTTTTNGGGC
CCCAANNAANNACTNGGGTTTTTTAAGGCCGAAGGGGGAAAGTTTTTTTTNAANAATTTN
GGGGGGAAGGGGGCNTCTTNcncnggnaaaaaaataaaanccccttttttttgggataaa
aaattttggaggnnaaaaaaaaaaaaaaaccacccgggggggggccaaaattttaaancc
caaggntttaaagggggggnccntttnnggggnngggcccnaatttnaaaaccttttngg
ggtttggttggggaaaang

Image Files
Larval GFP

g1 (->Large)

g2 (->Large)


CLOSE