Detailed Information [104609]

Strain Information
DGRC Number 104609
Genotype with FlyBase Link P{w[+mW.hs]=GawB}NP4116 y[*] w[*] / FM7c
Genotype P{w+mW.hs=GawB}NP4116 y* w* / FM7c
Break points/Insertion Site 1A1
Map Viewer
Related Genes EG:BACR37P7.2
Original Number 4116
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4116

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 1
General Information NP_lines
Embryonic Expression sg, pns (ch subset)
Larval GFP cns, fb, epi
Larval X-gal sg, tr
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np30205_0807
Strand Minus
Insertion Point 3401
Chromosome Band X
Flanking Sequence
gttnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAGCTGGCATGGCACAAAAATCGATGTTTATCGGACATGGCA
ACGCTGCTTGGAATGTGTAATCGCTAAAAGAAAATAGGGTGACACGGTTCCCAATTTAGC
TATCGCTAATTTGATAGGGCAGCACTGGCAAAGGCGTGAAAACAATTGTTATTAACGCAT
CTCAATTTATTTTTTTCTTAATATATAATCGTTTTAGGCATTGTGTTTATTAAAGTTTAG
CAAGATAGACCAAGCCACATATACTTACAGACGGCATAGTGCGAGGGGAATCCCACGTAG
AATGTAAGAAAAATGCGCATGCGCGGACGAAGATTGCTTCCGATTATTTTGTCGCTTCTT
TTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccg
ttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaa
gagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagt
caatcgatacagtcaactgtctttgaccctttgttactactctcttccgatgatgatgtc
gcacttattctatgctgtctcaatgttagaggcatatcagtctccngctnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Larval GFP

g1 (->Large)

g2 (->Large)


CLOSE