Detailed Information [105117]

Strain Information
DGRC Number 105117
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG42353[NP6088] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG42353NP6088 / FM7c
Break points/Insertion Site 14A9
Map Viewer
Related Genes disco-r CG9216
Original Number 6088
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6088

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 382
General Information NP_lines
Embryonic Expression vm, fg
Larval GFP sg, DT.
Larval X-gal sg, epi
Adult GFP neuron? associated with bristle. also prepattern-like in thorax.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42885_0912
Strand Minus
Insertion Point 15831911
Chromosome Band X
Flanking Sequence
ggnggnnnngnnaaggnnngnnnnnnnnngttttttnnnnngantactnggcgtgacact
ncanttnntgtatacttncggtaagcttcggctatcgacgggaccaccttatgttatttc
atcatgCCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTG
GCGTAATAGCGAAGAGGCCCGCACCGNTCGAAGAATACATAAGAGAGAACCGNCGCCAAA
GAACCCATTATTGTTGGGGTNCGNTTTCAGGAAGGGCAAGCCATNCGACATGTCATCCTC
TTNAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGA
GTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACT
ACTCTCTTCCGATGATGATGTCGCACTTATNCTATGCTGTCTCAATGTNAGAGGCATATC
ANTCTCCACTGAGCTTNNNTNTTTNNNNNGGGGNAANTNCNTTNNNNAATTTGAATACCA
ANGNANNNAGACTGGNTTNATNTTATGAATNGAGCTTTGNNCTCAAACAAGCAANATNCN
ACTTTNGNAAATATNNGNATTANNNATTNNNCTATGNNGANNGNNTATATANATATATNN
NNNNNNGNNNNNNNNNNNGNNCNNACCCNANANANNTNTNNNNNNGGGGGGGNGNNNANN
NNANAACAANNNNNNANNTNTNTNNCNNNNNAANCNNNNNNNNNNNNNCCNNNNANNNTN
NNNCCNNNNNNTNTTNNANAaaaaangnnnnnnnccnnnnnnnnnnnaaaaaaaannann
nnnnncnnnnaannaannaannnnnggnnnngnaannnnnnncnnnnnnnnncnnnnnnn
ncnnnaannngnnnnnnnnnnnntnggnnnnnnnnnnannnnnncnnntnaaaannnnnn
nccccnnnnnnnnnnnnnnaangnaanngnngnnnnnnaanannnnnnnnnnnncccnnn
nngnn

Image Files
Adult

a1 (->Large)

a2 (->Large)


CLOSE