Detailed Information [105402]

Strain Information
DGRC Number 105402
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP7237 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP7237 w* / FM7c
Break points/Insertion Site 1B5
Map Viewer
Related Genes EG:171D11.5 EG:171D11.1
Original Number 7237
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7237

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 11
General Information NP_lines
Embryonic Expression sg
Larval X-gal sg, oenocyte, fb, mt
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06505_0711
Strand Minus
Insertion Point 251153
Chromosome Band X
Flanking Sequence
tttttttggtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggnac
caccttatgttatttcatcatgCATCAAACTATAACCACTTGCTAATGTAAAGCACTTTT
TGACGTGGTCTTCGCCTTCGCCTTCGTATATCAACAATCGCCACACCATGCCAATACCAC
ACCACACCACCATACATTACCTCAAACCTATACAGATATATGTACATATATATTTCCATT
CATGTATATGTGTAGAGAACAGTGGAGAATAACTGGCATCAGAAATGGGCGGCTGCGCTG
CGTTCAGTTTCAGTGTAGCCACCGTTCGGAGAGCACGCgatcgaagaatacataagagag
aaccgncgccaaagaacccattattggtggggtcccgttttcaggaanggcaagccatcc
nacatgtcatcctnttnagaccaaatcaaattcatgaagagcatncctngggcatnaaat
ncaacggaattgnggagttatnatgatgagctgncgagtcaatcgatacagncaactgtc
tttggcccttggtactactntnttccgagatgatggcgcacttattctatgctgncntca
atggtagaggcatatcagtctccactgagcatntnnnnnnnnnnannnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnntnnnnnnnnnnnnnnnnnnncnnnnnngnnnnnnnnnnntnncngnnnn
nnnnnnntnnnnnnnnntnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatnntnnn
nnnnnnnnnnnnnnnnnnnnnnnnnntnnnntnntnnnnngnnnnnnnnnnnnnnnnnnn
nn


CLOSE