Detailed Information [112325]

Strain Information
DGRC Number 112325
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP0776 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP0776 / FM7c
Break points/Insertion Site ---
Map Viewer
Related Genes EG:23E12.3
Original Number 776
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 2153
General Information NP_lines
Embryonic Expression a small # of cells
Larval X-gal sg, epi, mt, DT
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40775_0907
Strand Plus
Insertion Point 29821
Chromosome Band Xh
Flanking Sequence
gtnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGGATGGAGAAAGCAGCAGCACAGCATAGCACAAACCCCATTT
CCACGGCACTCACACATACACAAAACAGTGCACTCACACGCTTCAGCgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca
agccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggca
taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca
actgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagtctccactgagcatnttttttttgggggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np65013_0309
Strand Minus
Insertion Point 29828
Chromosome Band Xh
Flanking Sequence
antnatttggggngaaaaaacnctgcaantcatgacgttaatggaatgtctcttgccgna
cgggcaccaccttatgttatttcatcatgCTCCATCCGTTCTTTTCCGCTCTTCGTGTGT
CGGATTCGTATTCGGGTTTTTTGTATGGGCTTGGGTGGTTCTTCTTCTTGGATGGATCCT
CTAGCTAGAGCATAGGNCACTNGCAAATTATTAAAAATAAAACTAGAAAAATAATTTCNT
CTAAATAATAAAANAAGAAAATTTAAANATAAATGGATATAANAAAGATTANGANANAAT
AAAAANNNNANATAANANNANAGGAANANNANNNANNANNNNNNNNNNNNNNNAANNNNN
NNNNNNAAAANNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNN
NNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannccccncccccccn


CLOSE