Detailed Information [112801]

Strain Information
DGRC Number 112801
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2151 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2151 / TM3, Sb1 Ser1
Break points/Insertion Site 95D1
Map Viewer
Related Genes CG12268 Gdh
Original Number 2151
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2151

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1613
General Information NP_lines
Embryonic Expression sg
Larval GFP gut
Larval X-gal fb, gut
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32615_0907
Strand Plus
Insertion Point 19759547
Chromosome Band 3R
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgGGCGAGAGCGGTGCAAACTTTTCACCGAAAAGCTCTGTGGGTGGAG
TGCCCGCTAGAAACGCGGCACCACCGCCGGCGGATTACTCGCTTCGTTGCCAGGGCGAGA
TTAGGTATTTGTTATCGGTTTCACGTTCACGTTTTTCTTTGACTCCAAGATTAAGCTATG
ATTTATCATCTTCGGCTATATGTTGAATTCAGGGGGGTACTGAGTTTCTTTTAGAAAGCA
CTTGAAAATCTAAGTAATAAACATCGTACAGTACAATACAAACGATATATACAAGGTATA
TTTTATATAAGGTGTTTTTTTAAAGGTTTTGCTAAATTTTTTATTTAGAGCTCATACTTT
CAGGAATTTACCACGTAACTTTCGGGCTTATCATGCTATTgatcgaagaatacataagag
agaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatc
cgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatc
caacggaattggggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtct
ttgaccctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctca
atgttagaggcatatcagtctccnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE