Detailed Information [113334]

Strain Information
DGRC Number 113334
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG3777[NP3544] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG3777NP3544 / FM7c
Original Number 3544
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3544

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Embryonic Expression cns (TU)
Larval GFP specific in tr node associated cells.
Larval X-gal sg
Adult GFP ant, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Guven-Ozkan T, Busto GU, Schutte SS, Cervantes-Sandoval I, O'Dowd DK, Davis RL.
MiR-980 Is a Memory Suppressor MicroRNA that Regulates the Autism-Susceptibility Gene A2bp1.
Cell Rep (2016) 14(7) 1698-1709 [PubMed ID = 26876166] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13255_0727
Flanking Sequence
anctntttngggnnaaaangcctttttttgtatacttcggtaagcttcggctatcgacgg
gaccaccttatgttatttcatcatgCGTAAGCCCTTCACAAGGCAGCTAGCAATATTTAA
AAAGGAGTAAGCTAGCCAGGCCAAATGAAAAACTGACATACAATCAACTTCGTATTTCAC
ACGCGGGAAATTTAACAAAAAATAAAAAACAAAAAAATAGTTTANGGATATGAAATCCTG
AAGGATTGGTAAACTAGAACGACCGAAGACGACTAACTGCTTGCCACCAAAAATGTTGGG
TTTTTATGTCCGTCGTCGGCACTCACACAATAAAATTCATTATTAGGATGTATATAGTGA
TAAAAGGAATTGTTTTTTTTTAACACAGATTGCCCGTATGTAAAAACCAAAGAATTCATA
TTATATAAAAAGAAACCACAAGTTGCTTATCGCTGTGAAATGAGGCTGGTAGTGCGCTTG
CACTATGGGGAATTTAACATGTTTTATTGGCATAAATTAATATCTCGTAAACTATTTAAG
ATACGATGAATTTAGAATTATTTTGGCAAAGGGGGGTGCCCCGCCCACTCCCATAAAAAT
TTTTTTTTAAAATCAATATATTCTATCTAATCCNCCAATGGTTTGGGAGTTNCCCCCTGT
TTTTAAATTGGNCCACAATCGGGACCAAACTTAAGGTCTTTTAANATTTTTATTGGNAAA
AAAATNTTTTCAAAGNCGCATTTNGTNCCCTTTTNTTANGGGCCCCATTGNGTGATTGGC
TNCCTAAAAANGGAATCTTCgggnaaaggnnccattaggggcctttcgcaaaaagncggg
ttaaccnggttggggttttaaggggggnattnatnccccttnaaaacttggcctancccc
natntnaaaaaantttttggaaccccaattatttttnnnaggccctaaaaanaaggnntt
ngngggnccnggggttttaanattaatat


CLOSE