Detailed Information [103496]
 

Strain Information
DGRC Number 103496
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}fru[NP0021] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}fruNP0021 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 91B2
Map Viewer
Related Genes fru CG7691
Original Number 21
Chromosome 3
Comments FlyBase Insertion: P{GawB}fru[NP0021]
NP line. Received from the National Institute of Genetics.
Also known as NP21 P{GawB}NP21 P{GawB}Np21 gamma neuron-specificGAL4-NP21 P{GawB}NP0021
Balancer TM6UW23-1
Cluster id 1538
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak, a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Siegenthaler D, Enneking EM, Moreno E, Pielage J.
L1CAM/Neuroglian controls the axon-axon interactions establishing layered and lobular mushroom body architecture.
J. Cell Biol. (2015) 208(7) 1003-18 [PubMed ID = 25825519] [RRC reference]

Goto J, Mikawa Y, Koganezawa M, Ito H, Yamamoto D.
Sexually dimorphic shaping of interneuron dendrites involves the hunchback transcription factor.
J. Neurosci. (2011) 31(14) 5454-9 [PubMed ID = 21471381] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05015_0711
Strand Minus
Insertion Point 14314960
Chromosome Band 3R
Flanking Sequence
attttngggnnnatnnncccnttttntntacttcggtaagncttcggctatcgacgggac
caccttttgttatttcatTTGCCCCAGGTTGCCGCATGCCGCAACACTCGGGAAAAAATG
TTANCAAAAAGGTTTTTAAGTGACGAGCAAAACATAGTCGAGAATATATAAAGTAATACG
TGGCGTATACTTAATATATTATGGTTGAATTTGGGTTAGTTNCATTTTTAAACAATTATT
ACTTATTTTTATTCATAGTTATATAACTAAATAAGTAATTATTTATTTAAATACATTAAA
GAACAACTCCTGGATTTTATACAACGTATTTCTTTAAATAATACTTAAATTATATTTATT
TTATTAAATTCAATTAAAGTAAACATAGTAATTTTGCAGTGCAGGGTCTAGGATGTGGCT
GTGCCTTTGCCCGTGGATGGACAAACATTTGTTGGTAGAGGAATTTTCATTTTATATAAG
AGGCAATCGCAGTGAACCGGACCAGCCCCCGNANGTTTTCGCAGCCAGCTGGGGGAAAAG
CTCANGCCGAGGCTGCTCAAGTGCGCAATTTTCTCACATGGCAGTCGCTGCTGGTGGTGT
AGTCCCATTTCCATTNCCATTNCCATTTCAGTCGCAGTCAAGTTGTCCCTNCAAAGGTGN
AGATTAAATGAACATGGCGCTGGCAGCAGAGTGGACAGNCAGACACCACATANGCTATGN
CCAGGCCCTGCCGTGTGATCGANAATCATAANANAGAACCGGCGCCAANAACCCTTTTTG
GTGGGGTCCGTTTTCAGGAAnggcagccatccgcatgttatccttttnaaccatcaatca
tgagagcatncctggcataaaancacggattgggggtnttatgagagctgcggtcaacga
tcagcactggcttgaccttggtctatctttccaggag

Image Files
Disc

d1 (->Large)

CLOSE