Detailed Information [103537]
Strain Information
DGRC Number 103537
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}poly[NP0135] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}polyNP0135 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87E7; -; 87E8
Map Viewer
Related Genes CG32853 BcDNA:GH02431 did
Original Number 135
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0135
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1469
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg, a small # of cells
Larval GFP gut, fb
Larval X-gal sg, gut, fb
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np05115_0711
Strand Minus
Insertion Point 9190058
Chromosome Band 3R
Flanking Sequence
acgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccacctta
tgttatttcatcatgGGTGAGAGCTTTTTATTGACAACGCAATCACTCACCAAACTTTGT
ATGTGACTGTGTGTATGTGAGTGGTGATGGTGGTGCTGATGGTATCTATTGGCATAAGAA
ATTATAACACTCGGGAATTACGGTGTAATTGTGAGCTTTACTAATATCTGGTATCCATTC
AATGGCGCATTTCCCATATGGTCATGGGGTAATAGTCATGAAAATGCCATGTGCAAATGA
CTCAAATTTTCCATTCAGAAAACATTTATGTAATTTCAAGAAAATCCGGGCGTGCGTCTG
CCGAGACCCATTAATCATTGTACCCTAATTAACGAAACATTATTATTTTGTGCCTAATTA
AATCGATTGCGTTGTGTTAATGCACTTTTAAGTCAAGGGTTAATTAGAATGTTTTTGTTT
GCCTGCACTTTGAGTAGTTAACGCTTCGAAGCGGAAAATCTGTTGCCTAGACGGTAATCT
TGGCCGTGATAAGAGTCCATAGCGAGAATGAATGCCCCAATATTTTCTCCACTTGNATTA
CCATAGNGCTTAATTCTTATTTAAATATTTTCTCGCACGTTTTCGGGGCATGTNCCACAT
TAACACTAAATTGGATCTCCTAGCTATTTTAGCAACTCTATTCCCTAGNGGTAAATTTTT
CTTTAAATCCATGGAAAAGACTCTAGTAAGNGCTNTAGTTNAAAAANAGCCCTATNAAGC
NTTTGCGCAAGCTTTTNTNCgcataggagtttangggccttaggggcttactgggcnttg
gcagcgctnncaaaccatntttggcttaaggggtggtttgcccctntttttnccaatntg
ttccnttaacccc

CLOSE