Detailed Information [103539]
Strain Information
DGRC Number 103539
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0138 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0138 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 57B20
Map Viewer
Related Genes CG15655 CG9394
Original Number 138
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0138
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 892
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak mesoderm
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np05125_0711
Strand Minus
Insertion Point 16145304
Chromosome Band 2R
Flanking Sequence
attttnngtgcactgnaatttaattgtatacttncggtaagncttcggctatcgacgggn
accaccttatgttatttcatcatgGGTCTCTCCCTCTCTCCCTCTCTCTCTCTCTCTCCG
CACAACGCCTCCTGTGGCTGCTTCCTCTTCCATTTCCTACGAGCGACAGATGTGCAGCTG
CCGACTGCGACTGCATTTGGATTCGCGCCCCCGACTCCCTGTTACTGGGATTTTGGGATG
CATTCCCGTACAAAGCATACGCATCTGGCAATTCGATTCCGGATTGAGCAAAAAACCACG
CTGATAACAGGATAATAGAGTGTTGAAAAATTATACAACTTTATGATTATgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgntggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttnagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaatcgatacag
acaactgtctttgacctttggtactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatggtagaggcatatcagtctcctngcannnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE