Detailed Information [103604]
 

Strain Information
DGRC Number 103604
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Mi-2[NP0394] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}Mi-2NP0394 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 76D4
Map Viewer
Related Genes CG7757 Mi-2 CR32216 CR32218
Original Number 394
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0394

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1993
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg
Larval GFP muscle, tr
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shimell M, Pan X, Martin FA, Ghosh AC, Leopold P, O'Connor MB, Romero NM.
Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing.
Development (2018) 145(6) [PubMed ID = 29467242] [RRC reference]

Yamanaka N, Romero NM, Martin FA, Rewitz KF, Sun M, O'Connor MB, Leopold P.
Neuroendocrine control of Drosophila larval light preference.
Science (2013) 341(6150) 1113-6 [PubMed ID = 24009394] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41395_0907
Strand Plus
Insertion Point 19825785
Chromosome Band 3L
Flanking Sequence
ganttaagtgttacttcggtaagcttcggcttcgacgggaccaccttatgttatttcatc
atgGAAGCGACCTAGTGTTGTTCTACTTGAGAGAGCGTTTTTTGAATAAAAATGAACGTA
TTTGAAAGCTAAAATAATATTTACTTTTCCAATTTATGTTTCATAGTTTTGTGGACTTTA
AGCGCAAGTAAACTTTTTCGAAATGCCAGCACACACATACCATTTACCAATTATACAAGC
ATATATATTTATAAAGATATGTATATGTATATACATGGCGGATATAAAAAAGCACCACTT
GTTGTTGACTTGATTGAATGCAGTGCGTGCGAGCGGGATGGCAAGTTGTGTTTCGCCAAA
GCAAGGNTAGATCGAAGAATACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGGTG
GGGTCCGTTTTCANGAANGGCAAGCCATTCGACATGNCATTCTCTTTAGACCCATCAAAT
TCATGGAGGGGCNTTNCCTGGGCATTAAAATCCAACGGGAATTGGGGGGGTTTTTNATGA
NGAGCTTGCCCAGTNAATTCGATACCAGGCNACTGGGCTTTGGCCCCTTTGGTNCCCACN
NTCCTTCCCAAGGAGGAAGGCCCCNCTTTATTNTTNTGCCGGGNNCNAANGGTNGGNNGN
CTTTTTAANNCCTNCACTGAGCTNNNTTTTTTNGGGGGGNNNNNNNNNNNCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCNTNN
NNNNNNNTNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnncnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnn
nnnnnnnnnnncnnnnnnncncnnn

Image Files
Disc

d1 (->Large)

CLOSE