Detailed Information [103614]
 

Strain Information
DGRC Number 103614
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0423 / TM2UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0423 / TM2UW23-1
Break points/Insertion Site ---; ---
Map Viewer
Related Genes CG40072 CG40075 CG40169 CG40181
Original Number 423
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0423

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2092 2126
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Deveci D, Martin FA, Leopold P, Romero NM.
AstA Signaling Functions as an Evolutionary Conserved Mechanism Timing Juvenile to Adult Transition.
Curr Biol (2019) 29(5) 813-822.e4 [PubMed ID = 30799245] [RRC reference]

Yamanaka N, Romero NM, Martin FA, Rewitz KF, Sun M, O'Connor MB, Leopold P.
Neuroendocrine control of Drosophila larval light preference.
Science (2013) 341(6150) 1113-6 [PubMed ID = 24009394] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05505_0711
Strand Minus
Insertion Point 2598232
Chromosome Band U
Flanking Sequence
actctttgggggcattgnccntntnttgtntacttncggtaagcttcggctatcgacggg
naccaccttntgttatttcatcatgCCTCTGTGCTTAAAGAATATGTTAGTGTTTTTGGG
AGAGCATTGCTCTTAGATGCTTAAGTATTTTGAGAGAGCATTGCTCTTGGATTCTTAAGT
GGAGGAGAAGCCTCAGAGAGAGCAGGCAGACTTTAAGATTTNTTTACAAGAATGGCTAAG
TGCCGCTGTCAAAGAATTTGTTTATTAGAATGCATACTGCGCAGATGGCATACAGTATGG
GGGTGTCAATATAATTAAACCAAAATGCAGAGTGGATATTTTTGTTATTTgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgaccctttgntactactctcttccgatgatgatgtcgcacttattcta
tgctgtctcaatgttagaggcatatcagtctcactncatcnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np54913_0309
Strand Minus
Insertion Point 5935815
Chromosome Band U
Flanking Sequence
anttctttgggggaaaaaaccccncctttttnngttaagntggatgccctcttgccgacg
ggaccaccttatgttatttcatcatgCACAGAGGCTTCTCCTCATTTTCACTTTCATTTG
ATTTTTAGTCTTAAGCTGAACGTTAATCAATAAACAACACAATCGATCCTCTAGCTNGNG
CTTAGGCCACTAGTGGATCTGGATCCTCTAGCTAGAGGCTTTNTTTTTTTTTTNNNNNNN
NNNNNGNTTTNNGGGNGNCCCNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GGGGGNNNTTTTTTNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnann

CLOSE