Detailed Information [103625]
Strain Information
DGRC Number 103625
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Mmp2[NP0509] / CyO
Genotype w*; P{w+mW.hs=GawB}Mmp2NP0509 / CyO
Break points/Insertion Site 46A1
Map Viewer
Related Genes Uba1 Mmp2 tRNA:M3:46A
Original Number 509
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0509

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 636
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg
Larval GFP gut???
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Lai JS, Lo SJ, Dickson BJ, Chiang AS.
Auditory circuit in the Drosophila brain.
Proc. Natl. Acad. Sci. U.S.A. (2012) 109(7) 2607-12 [PubMed ID = 22308412] [RRC reference]

Yasunaga K, Kanamori T, Morikawa R, Suzuki E, Emoto K.
Dendrite reshaping of adult Drosophila sensory neurons requires matrix metalloproteinase-mediated modification of the basement membranes.
Dev. Cell (2010) 18(4) 621-32 [PubMed ID = 20412776] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np08505_0711
Flanking Sequence
cttncttggggcaangccctttttgtatacttncggtaagccttcggctatcgacgggca
ccaccttatgttatttcatcatgTGCCAGCgatcgaagaatacataagagagaaccgtcg
ccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtca
tcctcttcagaccaatcaaatccatgaagagcatccctgnncataaaatccaacggaatt
gtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttg
ttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggc
atatcagtctccactgaagccaatcttatctgncncntttncctnnctgttnnctntcgt
ngnnnnnctncncncnccntntntcgcctntnnttttnctttnctncngccttttttttc
ctttccctttcttnncccctttntcnnntcctgntcccgccttttnccngccnntttntt
tnncttngggnggcntgtctnttccccccncctngncnnntctgtttnttntctttcccc
ccgcgntttttncttgttcctgtgtttnntnnnctcnncttctnntnccnnnccncgcct
ttttttnttctccnccccnttncgtttttncgntctctccnngcggncnncgcctttttn
tnntctnngnngnttttttttntttnttgnngtctcgtccgcncctgngcnctccngncc
cnttngccnttgnnatctntgnnncnttttgnttttnnattgtctntcntttccgccgnc
ntttnctncatttcttcccnctcccccttttttttcccccccccntactcttcnnttntn
ntttntctnttttttttttncccnccctttttttnncccccnctcctcntccaattgnnt
ctgtcttnnntgtcnntgttttcgcntnctntnttttnctcccntcnattttgnttatct
ttttctnntttcnttcatccnntncnttgtcgctcccccgtccttttttcnccncctctt
tncccacncgttccccnngannanntatatat

Library Name / Clone Name np / np55553_0309
Strand Minus
Insertion Point 4744640
Chromosome Band 2R
Flanking Sequence
GANGTTTCGTNAGTGGATGTCTCTTGCCGACGGGACCCCTTATGTTATTTATNATGCGCT
GGCATATCCGCCCAAATGAAGAGAAGCTACTCTGTATTTTTGTGCTCTTTGTGCCCGCCT
CTTCAAGTCGCTTCACGTCGAGGCAAAGTCAGCAGTTCAGTCACATTTAGACATCCGCGC
GGTAAACCCGCTTTCGGNGGTATAACGAGATTTTTTATTTTCGAATTCGACAGAAACNAA
TAAATGGAAAAAGGGNAAATTGGGATTTATGCTTGCCCAAAACNCCCCAATAAAANANCA
CCNNCCACTTTTNNCGGTTTCTTTTGGGGGGGGNACNAANNGNNCNNACCGNTGGCNGGN
ATNGGGTTACCNCAATNGGGAATTGGNGGTGGNNTTNGGCCTTTTCCTAAAAACCGGTGA
ACCAGGGAAGGCNTTTCTTTGGGNNNGCCCTNGNGGNCTAATAAATGGGGTTTTGGGGGC
CANGGGNNTTTTNTTAGGGGNCTTCTTNTCCCCNCCAAATTTAAATNTTNTCANGCCNAA
CCAAATTAAACGCCCCANGTTCCTGGTTTTCCCNCCNTCCNNTTNCGTCNTNTGTAAAAN
AGNNCAAAAGGNCGGAGGGCCCAGNNGGAANGGAAGGCCAGGGAAAGAANCAGGGCCCCC
ACCAAAGNGGNAGGCCNAAAACNCCANACNAAGAAGCNCCAACCGGAAAACGGGAATACC
CCGGCCNATTCCCCNACGGTTCCCGGCCAAAACAAAGGNTCTTTCCGGGGTTTTTGGTGN
GGTGGTGGCAGGTGNTTTTAtgcctgccggggtttncngngggaggncccccaacgcccc
ttggnttttttgttaaanccccccggggcgggggag

CLOSE