Detailed Information [103786]

Strain Information
DGRC Number 103786
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0845 / CyO
Genotype w*; P{w+mW.hs=GawB}NP0845 / CyO
Break points/Insertion Site 42A14
Map Viewer
Related Genes bin3 l(2)k14710
Original Number 845
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0845

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 525
General Information NP_lines
Embryonic Expression AS
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18395_0807
Strand Plus
Insertion Point 1352679
Chromosome Band 2R
Flanking Sequence
gnnnttgttanngtgcactgaantttangtgtatacttncggtaagcttcggctatcgac
gggcaccaccttatgttatttcatcatgGTCCGTCCCCTGTTAGCTGCTAACATGCTAAC
TCTCGGTCAGCTGTTCCATCTTTTTTTTTCCACAAGCGTGTGCAATCCATCAGAAGCTGT
TCATATTGNNAATNGAATNGATAAGACCCAGGGTGGGAGCTCTTTCTNAAAAATANGAAA
CCTCNGCTCGCCAAATAGAACATTATCACATTATCCCTCATATTAGCAAGATGTCTTNAT
TTNATGTNGTTTTCTNACAACAGTNATGCATATGCATATGTACATACTATTATAAACTTC
ATTGTTTTTCGATTACTAATTTTTTCATTTTTAAAATTGGCAACACTGGNGGGCTNTGTT
AACCGAGAATATATATAAAAATATGTTAGTTGTAAGNGTTTTCTTGCAGGAGACTGACGC
ACTTATTAGAGCTCCGCGAACGGAATCATATTTTACGGTTTTTTTTTTTTTTTNAAAAAN
GGGGGGGGAATTTNNNGGCCCCCCCNAACNAAAANGGNAAAAAAANTNANGNCCCCCNNA
AAAAANGGGGGGGCTTTTTGNGGGGGGNNNGGTTTTNNCCCCNAAAAAAAATNTTTNNNN
NNCNNNNAAAGGCCNCCCCCCCNNGNGGNTTTTGNCCCCCCCCNATANNNNNNCCCNGGG
GGNNNTTNNNNTNNCGGGGCNCCCCCCCNTNTTNCNTATTTGGTNGGNNGGGTTNTAANA
AANNTNGTNNCNNNNTGNGCgnnnnanttntnnccacccnnannnnntnttttaaggggg
gggggggngccnaaaaancnnncnnnggnnnccncnnnanncncccnnaaanggnngngg
ncnnaaaaaggggnnnnctngnnccccctnttntnaananaaaaaaaaaaaan


CLOSE