Detailed Information [103813]

Strain Information
DGRC Number 103813
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}l(2)not[NP0908] / CyO
Genotype w*; P{w+mW.hs=GawB}l(2)notNP0908 / CyO
Break points/Insertion Site 59F6
Map Viewer
Related Genes l(2)dtl CG11299 l(2)not l(2)tid
Original Number 908
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0908

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 930
General Information NP_lines
Embryonic Expression a small # of cells
Larval X-gal sg, DT
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08795_0711
Strand Minus
Insertion Point 18750702
Chromosome Band 2R
Flanking Sequence
NGGGCCAGGNNNTGTNNGTTTTTTTGTNNGGACNAACGGGGGTNAAAANCCCCTNACTTG
GGGCGNCGGAAAAACCCCGGCTATNGACGGGNACCACCTTTTNTTATTTCATCATGAACC
GGCGTGAAAGCGAATGAAATATCGTTATATACCGTTAAAGTTAAAAAAGCCGTATATTAA
ATAAGTTAACTAATGTTTTGCCTTTAAAATAAATATGAAGTGTAACTCAATGGATATAAT
NTTTTTGCCAGGCCCAAACAGACTGAAATACCTGCTTAGNGNNTGAAAACAATGACTAAT
TGCAATTCCTTCTATCAAATTTATGATAATNGAAATTCTTCGATTTTCGATTTCCTAGGC
GACACAGGACCTCTTGTGTATCCAGCCGCCTTCGTGTACATCTACTCGGCTCTCTACTAC
GTCACGTCCCACGGAACGAACGTTCGCCTGGCGCAGTACATCTTCGCCGGGATCGAAGAA
TACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGGTGGGGTCCGNTTTCAGGAAGG
GCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGG
GCATAAAATCCAACGGAATTGNGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAG
NCAACTGNCTTTGACCTTNGNTACTACTCTCTTCCGANGATGATGNCGCACTTATTCTAT
GCTGNCTCAATGGTAGAGGCATATCAGNCTCCACTGAGCATNNNNNNNNNNGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE