Detailed Information [103877]
 

Strain Information
DGRC Number 103877
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}phl[NP1079] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}phlNP1079 w* / FM7c
Break points/Insertion Site 3A1
Map Viewer
Related Genes CG14049 phl
Original Number 1079
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1079

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 72
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells yolk, oenocyte, gut subset
Larval GFP gut
Larval X-gal fb, hg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Bai H, Kang P, Tatar M.
Drosophila insulin-like peptide-6 (dilp6) expression from fat body extends lifespan and represses secretion of Drosophila insulin-like peptide-2 from the brain.
Aging Cell (2012) 11(6) 978-85 [PubMed ID = 22935001] [RRC reference]

Luo J, Liu Y, Nassel DR.
Insulin/IGF-regulated size scaling of neuroendocrine cells expressing the bHLH transcription factor Dimmed in Drosophila.
PLoS Genet. (2013) 9(12) e1004052 [PubMed ID = 24385933] [RRC reference]

Sousa-Nunes R, Yee LL, Gould AP.
Fat cells reactivate quiescent neuroblasts via TOR and glial insulin relays in Drosophila.
Nature (2011) 471(7339) 508-12 [PubMed ID = 21346761] [RRC reference]

Amoyel M, Hillion KH, Margolis SR, Bach EA.
Somatic stem cell differentiation is regulated by PI3K/Tor signaling in response to local cues.
Development (2016) 143(21) 3914-3925 [PubMed ID = 27633989] [RRC reference]

Avet-Rochex A, Kaul AK, Gatt AP, McNeill H, Bateman JM.
Concerted control of gliogenesis by InR/TOR and FGF signalling in the Drosophila post-embryonic brain.
Development (2012) 139(15) 2763-72 [PubMed ID = 22745312] [RRC reference]

Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev. Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17345_0807
Flanking Sequence
atttttgngtgcactgactttntntgtatacttcggtaagcttcggctatcgacgggacc
acnttatgttatttcatcatgGTCCAGTGTCTTGCGAAAAGGAAAACGAAAACGAAAAAA
AAAANTTTTTTTAAAAAAAAANCAAAAANCCCNGTAGGCCCAANCAANNGCTTAAAATNA
AACANTTNGCCGGCCNTNACNNATTAAATNAATTTTGGGNCNCCANGGNNCCNAGNNTTG
GNGGGNGTNTAAGGGNGGNATTGATTGGGGNAGGNCTTGNGNGTTTGANAGCNTNAANNC
NGGGNAACGTNAGTCCNCCNAANTTTTGGGGGNCAANATNTTTTTTTGGGGCCNNATCGA
AAAANACANAANAAAAAACCCNCCCCAAAAAACCCATTTTTGTNGGGGNCCGTTTTNAGG
AAGGGCAAGCCNTCCCNNATNTTNTCCTTTTTAAACCAATAAAATCCNTGAANNGCCTCC
CTGGGCANAAAATCCANCGGAATTGGGGNGTTTTTATGATGNGCTGCCCGGGCAATCNAN
ACAGGCAACGGGCTTTGACCCTTGGNACCACCTCTTTTCCCAGGAAGAGGGCCCNCTTTT
TTTTTGCTGGCTNAANGTTAAAGGCATATNAGNCNCCCTGACCTNNNNNNNNNGGGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnn

Library Name / Clone Name np / np58163_0309
Strand Minus
Insertion Point 2091594
Chromosome Band X
Flanking Sequence
tttnctcgcacttattgnagcatacgttaagtggatgtctcttgccgacgggaccacctt
atgttatttcatcatgCACTGGACTTTGCTTCCAGAGACTTTGCTGTCTCGCTCGCACTT
CCACCTGCAGTCCACGTGCTGCGCATTCGCTGCATCCTGCTCTCTCATTCGCACGCGCGT
AAAGTGAGGCTTCGTTTTGCGCTGGCGTCGCGGCAACGGTTCTTTTCCAATTTGGCTGTG
AAACAACGAAGAACGTTCTTCCGAGCGAGCGAAGAATTCGCTAAGAGTGCAATTAAAAGC
GTGAAAAGCGGAAGAAAGGCAGGTGCGAAGAACGGTCTTCCTGGCAAACAACGAGCGAGT
AGAGTTCGTCAAGAGTGCAATTAAAAAAAAAAGNGTAAGATCCTNTANCTGGGCNTTTNG
GCCACTAGNGGATTTGGATCCTCTAGCTGGNNNNTTNNNNNNCNNNNAANNNNNNNNNNN
NNNNNNTTNNAACCCNNNNNNCNNNNTNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE