Detailed Information [103879]
 

Strain Information
DGRC Number 103879
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG14200[NP1086] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG14200NP1086 / FM7c
Break points/Insertion Site 18C8
Map Viewer
Related Genes CG12233 CG14200 Pfrx
Original Number 1086
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1086

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 452
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression few cells, a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Benna C, Bonaccorsi S, Wulbeck C, Helfrich-Forster C, Gatti M, Kyriacou CP, Costa R, Sandrelli F.
Drosophila timeless2 is required for chromosome stability and circadian photoreception.
Curr. Biol. (2010) 20(4) 346-52 [PubMed ID = 20153199] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19145_0807
Strand Minus
Insertion Point 19241355
Chromosome Band X
Flanking Sequence
actttttngngtgcactgaattttnntgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGTCGAGATGTGGAAGACGAAGAGAGCAAGAAATAGAC
TAAGCATGCACGTTCGTGTGGCGCGTCACTTTGGACGCATGTACGTACAATATCGCCAAA
TATAAAAAGAAATGACTTACTTTTGCCGCGCTTAATGAACTCCTCCTTGTGCTCGCATTC
GAAGGGATAAATAAGCTTCGCGGAACTCACTTGCTCGCTGCGGACAATGAAGAAAGAAAA
AGAATAAGAAAAAGCATGTCACGCTAAAGTTGAAATGGGCAAACTCACAAGGTTTTCTCG
TTGAAAAACGCCACAACTGCGTACGGCGGGCGCGTGGTGTTGACGAAACGAAAGTCCTGC
GACGAGGTCACTTCGCCGGGCCACCAgatcgaagaatacataagagagaaccgtcgccaa
agaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcct
cttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgg
agttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgtta
ctactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcata
tcagtctccnctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE