Detailed Information [103880]

Strain Information
DGRC Number 103880
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG10962[NP1093] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG10962NP1093 / FM7c
Break points/Insertion Site 8C4
Map Viewer
Related Genes CG10962 CG15364 CG4040
Original Number 1093
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1093

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 230
General Information NP_lines
Embryonic Expression sg (SG)
Larval GFP mt
Larval X-gal mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Yin S, Qin Q, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for zinc excretion in Malpighian tubules.
BMC Biol. (2017) 15(1) 12 [PubMed ID = 28196538] [RRC reference]

Qin Q, Wang X, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for dietary zinc absorption and regulation.
BMC Biol. (2013) 11 101 [PubMed ID = 24063361] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19195_0807
Flanking Sequence
ATTTTTTGGGTGCACTGACTTTATNTGTATACTTCGGTAAGCTTCGGCTATCGACGGGAC
CACCTTATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAAC
CCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCA
GACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTA
TCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTC
TCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTC
TCCACTGAAGCCATCTTATTTTTGGGNNNNNNNNNNTTNNNNNNNANGNNNGNNNNANNN
NNNNNNNGNNNNNTNNNNNNNNNNNNNGGANGCCNANTNNNNNNNNNNNNNNNNNNNCNA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58633_0309
Strand Minus
Insertion Point 8783993
Chromosome Band X
Flanking Sequence
GNAGCNTCCGTNAGTGGATGTCTCTTGCCGACGGGACCGCCTTATGTTATTTAATNATGG
TGCGGATACAGGTGCGGATACTCAGCTGGCTAGATAAACGGATTAAGGAAGTTGGCGAAA
ACGCTCTTATCAATGGATTTCGTGCAGAAGAAGAAACTGCTATGTAATCGCCAAATGCGA
TAAGGTGGTTATATAAGTGTACTTGAAAGTTCTTTTCTTTTCTCAGAAGAAATTATGATG
TATGTATCTGCAATCTAAGCTTTGAAAGTAAGATAGTTCTGTGCACGTATCTATGAATAA
ATAAATACAAATAACTTTAGATATATTAGGTACAAGTGAGATAGAAGTTCCTTTTCTGTT
TCTTTAAGTATGAGAGTTTTATTCCCATATAATTCTATTAATGGTAGGCATAATTTGACT
TGATTTTAAAGTAGTCTATCATTAAGTAAATTGAAAACCTCATTTAGCTGGCAATAAGAA
GTTAACTACAAGAAGTTCTTCCCTATGTGATTCTGTTTTTTCTGTCTTGCTGCTGCACTC
GGTTCATGTGGGCGTCAGGGGTTAACGCAATTAACCCGTNTCGTGGTGCCGCCTCAATCA
ATTTTTNTTAAAATGTCATTTGACATGCCCGAGCATGCAACCGTGTTGCAGCAGGCANCC
AAATGACGGGGACCGCGATTTGAAGAGCCTTTTTATTTAGTTTTTTTNNTGGGNNCTTTT
TNCTGCAAACTTTTATTCTGCAGGTTTTTTTTTTTTGGCCTAAANCCCCTNCCCCCCTAT
GCCNNTTAGCNATGTNTGGGgtnnngtnnanntanannnggncaantgcncttnaaaggc
cccgnnaannttntcngnaaanncnttnncttttttncnaacacatgntnctcngggngc
nngtttcaaangtgggtgnattcnnaaagcncccccatnncccctntannnncncccttt
ancccnccnaaaanantnccnnn


CLOSE