Detailed Information [103911]
 

Strain Information
DGRC Number 103911
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Sema-1b[NP1166] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Sema-1bNP1166 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 54D5
Map Viewer
Related Genes CG4966 Sema-1b CG6459
Original Number 1166
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1166

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 831
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression terminal tips
Larval GFP oenocyte
Larval X-gal fb, epi, gut
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Wittes J, Schupbach T.
A Gene Expression Screen in Drosophila melanogaster Identifies Novel JAK/STAT and EGFR Targets During Oogenesis.
G3 (Bethesda) (2019) 9(1) 47-60 [PubMed ID = 30385460] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03425_0711
Strand Minus
Insertion Point 12743041
Chromosome Band 2R
Flanking Sequence
NGTGCACTGCANTTNTNTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCCCTTNTG
TTATTTCATCNTGGTCTAGCCCACGTTCGGTTCGCGGTCCGCTGGTCAAACTCATGATAG
TAAAAAAAAAAACAAAAACGAAANCAGCCGAAAACNCAAGACNCAAAACACAAGTAAGCC
GGAAAGAAACTGGNGANAANAAAGGGNGCAGAATTCCANGTAGCCGTTATNTAAGNGGAT
TNAATTATCTGATTCGGNAANAAAAGCAGATTCAAGACAAAGGGGAAACCCAAATGATAA
ACAAACAAATTTATGGCGGATNTAAACAAAATTTTTTATGCGTTTCAAAAANAAACNCNA
TNGCTGTCTACGNGCTNTTTGGCCAACTTACATACTGTTTCGGTTTGATTAGTCAAAAGT
TCNCTGGNTTTTGGGCTCGCTCGANAAANGATATTGCCTCGCCGNGGGCTNACTGAAAAA
ATTNTAATTAATTTTTTAACCCCCCTTNTGCCAGGCATTGGTTTTTTTNAANTGGAGGGT
TNGGGTTTTCCCTTTTGCCCCCCCCAGCTTATTGGCTTTAAATAAAAACCAANAGGTTGT
TTCTGCGGGGGGNAATCATTGGGGGCNGTNGNCCGCTGGNCNCCTCGAAATCCTTNTAGC
CNNGATGCCTTGAANCCAGCAAGCAGNAGGCNACANGCGCGCGGGNGNCCATATANNCCC
CCNGGTTNTTNAGNCCCAACCTTTTCGGCCGNNGATGGGGGAGANNTTNGGGGCCCNTNA
AGAAANGCGGGGGGGGNGAGgggttttaaaaggcnggngggngngnggcncggccaggcc
tttccacncnngcaggccggggggcccctttnggcccccgnggcaaagnggcttgnatna
ttaaanctgggnggggggggggggnntnnttttgggncnttttctctanaagcccagaga
angngccccnagaccnaccccttttngnggggggnntttttttc

CLOSE