Detailed Information [103953]
 

Strain Information
DGRC Number 103953
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}wun[NP1243] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}wunNP1243 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 45D3; -; 45D4
Map Viewer
Related Genes l(2)k10201 wun wun2
Original Number 1243
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1243

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 624
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression pns subset? (SG)
Larval GFP cns + pns
Larval X-gal oenocyte
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stratoulias V, Heino TI.
MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain.
Cell. Mol. Life Sci. (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03905_0711
Flanking Sequence
GGANGGAGGGGACNGNNNTNGGGGNNTGNACNCAAAAAAGAATTTTAAANNGGTTTGTTG
GGGNGGAAAACCCATTNAGGGGANACTNGGGGGAAANCCTGGGGCTNAGCGGNGGGGACC
ACCCTTTANGGTANNCCAACATGGCCGGCAACGCCAATGNANNAGAGAACACTCGGGGGG
AAAAAGCANGAGGAGCCGANGGAGCGGGCGACAANAGCNNAAGNAGNCNNGANCGAGAGA
GNACACAGGAGAGNAACNGNCCGNCGAGAANCCAGAAGGNGAAAGGNGNGCTNTNNANAG
GGANAGNNAGNGCCANCNNCAGAANNAANGCAGGGGCNAACCCNNCAACACGCAGGAAAA
ANCAACCCANGGGGAAAAAAAGNCCAACNNCCNCGNANGAAGCTTANCAGANAAGAGGCA
GNCAAAGNCAANNGCANANCGGCCAAGCGGGNNCNCGNNCNAGCGGACAGNACCNAANGN
CGCNCAGGANCAAAGNCNGNGACANGAAGNNGNNGGCCGCCCNAAANGNAGAGGAGGAAA
ANAAAGNGGCNGCAGGGANAAGGAAANNNCAACGAGCGAGAANNNAAAAGNGCCNAGGGN
GAAAAGNCGGAAAGGAAGCGANGGACACGAGACGNAGNAAAAAAGGGCCAAGGAAAACAC
AANACGANNCAAGNNNCCANAAAGAGAAAAAANNCNCNANNGGGNCACAGNNCGCGGGAA
GAAGAGGATGGNGAGAAANNANAGAAGNCGAAAANANAAAANAGAANANGNGNAANACAA
ACAAAANGCGNNACGNNGGNgcgcgggatangngcagataaatgcanacatgaacanncn
aatgngcacgacacnaggnnaaaggaagangggctagacnncngngngnncgaagcagaa
gaaacagnnaaaggcngagnanagaanancncggcaangnnnnaananntagnagnngcg
cancgagcaaggcggaacgacnagncaaaaaaggaacggaatgtgacaacanggcnangn
gngnaagaagaggacaaaaaanaagacancnaacnaataaaanaaaagaagnanaaagan
ggnngcangncnggcngncgagagcagnganngagaganacncaacacaagnnagaacac
ncnagnannagnnaaaananaagaanaagacgacnaaacncaanacnagaacagacaagc
aacaanaganattncacgagaganaggcgcgcgaataaaagtaagaggtgggngacgnna
cgacnnngaaaaacaaaaaananaa

Library Name / Clone Name np / np54443_0309
Strand Minus
Insertion Point 4466271
Chromosome Band 2R
Flanking Sequence
attttttggtgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacggga
ccaccttatgttatttcatcatgATTTACCCTATCAACGTGAAGTTCGAACTAGTTAATC
TCTTGTGCTCATGTAGATCCTCTAGCTAGAGCTTTGCGTACTCGCAAATTATTAAAAATA
AAACTTTAAAAATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCCCNGCGCAT
GCTCAGGGGGATAAACAACAATTATANCGGTGTCTCACTCAAACCCAACGGANCTNNTAN
GGNNCTATCNNNNACNNTCGCGNTNTTTGANNNAANCCCAAAAGGGGNTGTATNGGGCNC
NNGGCCCCACTNTNGTGTTTTTGNCTGAANNNCNNCCNTGNANGNGNAGGGCNNACNANT
AAAANTCTTNTGCTCNNTGNAGACNCTCCCNAGAGNNTTNNGNCCCCCNNANANTTNNNN
TGNGNNNNTNAAANTNNNNNCNNNNNNNNTNGNNNNNGNGGGAANNNNAAACCCNGNNCA
TNTNNNGGGGNNAANNAAAATNNATNNNNNNNGNNNTTAACNNNNNNNNANNTNNNGGTT
NTNNNNNNTNNNNNNNNGNNNNNNNNNNNNCNNANNNNNNNNNNTNNNNNNNNNNNNNAA
AAAAANNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNANNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnna

CLOSE