Detailed Information [103963]

Strain Information
DGRC Number 103963
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}mrj[NP1273] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}mrjNP1273 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 52F9
Map Viewer
Related Genes CG8448 CR30238
Original Number 1273
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1273

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 802
General Information NP_lines
Lethality semi lethal
Embryonic Expression weak epi, cns
Larval GFP no larva
Larval X-gal epi, tr(all),
Adult GFP no adult
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Riedl, Julia
Identification of neurons controlling orientation behavior in the Drosophila melanogaster larva
Doctoral Thesis, Universitat Pompeu Fabra (2014) [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20615_0807
Strand Plus
Insertion Point 11274216
Chromosome Band 2R
Flanking Sequence
tgnattnantgtnacttcggtaagcttcggcttcgacgggaccaccttatgttatttcat
catgGGGGGAACATTCGGAGAGAGAGAAAAAGGAGAGCGATTTTTACGGAGAGATTCTCA
GTTTTTGCACCAACTCGACTCATTGTTCTTGTTGTATCTCACCGGAAGTTGTTACGCCAA
TACTCGAAGCCCTATCTCTGCGCTATCATTTATCTTTCGGGCACTTTCGTTATCAGAGAG
TGTCGTATATTAGAGGCCgatcgaagaatacataagagagaaccgtcgccaaagaaccca
ttattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagac
caatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatca
tgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttggtactactctct
tccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctcc
actgagcatntttttttttnggngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnaangnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnn


CLOSE