Detailed Information [103985]
 

Strain Information
DGRC Number 103985
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Myo61F[NP1320] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Myo61FNP1320 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 61F6
Map Viewer
Related Genes CG9153 Myo61F
Original Number 1320
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1320

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1740
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP gut
Larval X-gal sg, mg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20255_0807
Flanking Sequence
ANTNNTTNGGCGTGACACTNCAATTTNTGTGTATACTTCGGTAAGCTTCGGCTATCGACG
GGCACCACCTTATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAA
AGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCT
CTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGG
AGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTAC
TACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATAT
CAGTCTCCACTGAGCATCTTNNNTTTTNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np59053_0309
Strand Minus
Insertion Point 1300134
Chromosome Band 3L
Flanking Sequence
tttactgcgcacttattgcagnctacgttaagtggatgtctcttgccgacgggaccacct
tatgttatttcatcatgATGTGGATTGAAGACCCAGGAAGCGAACGGAGGAGCGAGCGAA
GCGGCGAAATTGAGGTGCCGGTGCCTAAACGCTCGCTTTATTAGAGGAGCATCACCATAA
ACCAGATCCTCTAGCTAGAGCTTTGCGTACTCGCAAATTATTAAAAATAAAACTTTAAAA
ATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCCACGGACATGCTAAGGGTTA
ATCAACAATTATATCGCTGTCTCACTCNNACTCAATACNNCACTNANAATACTATTNCNT
TNACTCNCNCTTNTTNNAAGCATACNTTAAGNGGNTGTNTNTTNNCNNCNNNNCCACCTT
NNNNTNTNNATNNNNANNNNNNNNNNNNACCCNNNNNNNNNNNNNNNNNNNNNNNNANNN
NNNNAANNNNNNNNNNNNNNNNNTAAANNCNNNNTNTNNNNNANNNNNNNNNNNTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE