Detailed Information [104055]

Strain Information
DGRC Number 104055
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1624 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1624 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37E2 - 37E3
Map Viewer
Related Genes CG10026 CG10034
Original Number 1624
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1624

NP line. Received from the National Institute of Genetics.

Also known as tj-GAL4, tj-Gal4, traffic jam-Gal4, traffic jam-GAL4
Balancer CyUW14
Cluster id 1243
General Information NP_lines
Lethality lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP weak
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2016-04-18
Research papers using this strain
[Please submit your publication]
Ku HY, Gangaraju VK, Qi H, Liu N, Lin H.
Tudor-SN Interacts with Piwi Antagonistically in Regulating Spermatogenesis but Synergistically in Silencing Transposons in Drosophila.
PLoS Genet. (2016) 12(1) e1005813 [PubMed ID = 26808625] [RRC reference]

Isabella AJ, Horne-Badovinac S.
Dynamic regulation of basement membrane protein levels promotes egg chamber elongation in Drosophila.
Dev. Biol. (2015) 406(2) 212-21 [PubMed ID = 26348027] [RRC reference]

Lenhart KF, DiNardo S.
Somatic cell encystment promotes abscission in germline stem cells following a regulated block in cytokinesis.
Dev. Cell (2015) 34(2) 192-205 [PubMed ID = 26143993] [RRC reference]

Lengil T, Gancz D, Gilboa L.
Activin signaling balances proliferation and differentiation of ovarian niche precursors and enables adjustment of niche numbers.
Development (2015) 142(5) 883-92 [PubMed ID = 25633355] [RRC reference]

Sarikaya DP, Extavour CG.
The Hippo pathway regulates homeostatic growth of stem cell niche precursors in the Drosophila ovary.
PLoS Genet. (2015) 11(2) e1004962 [PubMed ID = 25643260] [RRC reference]

Cetera M, Ramirez-San Juan GR, Oakes PW, Lewellyn L, Fairchild MJ, Tanentzapf G, Gardel ML, Horne-Badovinac S.
Epithelial rotation promotes the global alignment of contractile actin bundles during Drosophila egg chamber elongation.
Nat Commun (2014) 5 5511 [PubMed ID = 25413675] [RRC reference]

Hetie P, de Cuevas M, Matunis E.
Conversion of quiescent niche cells to somatic stem cells causes ectopic niche formation in the Drosophila testis.
Cell Rep. (2014) 7(3) 715-21 [PubMed ID = 24746819] [RRC reference]

Clough E, Tedeschi T, Hazelrigg T.
Epigenetic regulation of oogenesis and germ stem cell maintenance by the Drosophila histone methyltransferase Eggless/dSetDB1.
Dev. Biol. (2014) 388(2) 181-91 [PubMed ID = 24485852] [RRC reference]

Lewellyn L, Cetera M, Horne-Badovinac S.
Misshapen decreases integrin levels to promote epithelial motility and planar polarity in Drosophila.
J Cell Biol. (2013) 200(6) 721-9 [PubMed ID = 23509067] [RRC reference]

Rozhkov NV, Hammell M, Hannon GJ.
Multiple roles for Piwi in silencing Drosophila transposons.
Genes Dev. (2013) 27(4) 400-12 [PubMed ID = 23392609] [RRC reference]

Lerner DW, McCoy D, Isabella AJ, Mahowald AP, Gerlach GF, Chaudhry TA, Horne-Badovinac S.
A Rab10-dependent mechanism for polarized basement membrane secretion during organ morphogenesis.
Dev. Cell (2013) 24(2) 159-68 [PubMed ID = 23369713] [RRC reference]

Lim JG, Fuller MT.
Somatic cell lineage is required for differentiation and not maintenance of germline stem cells in Drosophila testes.
Proc. Natl. Acad. Sci. U.S.A. (2012) 109(45) 18477-81 [PubMed ID = 23091022] [RRC reference]

Olivieri D, Sykora MM, Sachidanandam R, Mechtler K, Brennecke J.
An in vivo RNAi assay identifies major genetic and cellular requirements for primary piRNA biogenesis in Drosophila.
EMBO J. (2010) 29(19) 3301-17 [PubMed ID = 20818334] [RRC reference]

Leatherman JL, Dinardo S.
Germline self-renewal requires cyst stem cells and stat regulates niche adhesion in Drosophila testes.
Nat. Cell Biol. (2010) 12(8) 806-11 [PubMed ID = 20622868] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26025_0807
Strand Plus
Insertion Point 19442138
Chromosome Band 2L
Flanking Sequence
gtnangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgCCTCGCACCAAAAGCAAAAGCATCAGCGAATGGCGTTCGAGC
TCGGTTTTGTTTGTTGTTGGGCTGGTCGGCTTTTTGGTTTTGGCAAGTCGTTTTGTTTGT
CGGCTGTTGGGAAAAGGAATGGGTGTGTGTGTGTGGGTGTGCGCGCGCTGCGCTGCCATT
CTAACAGTTATCATCAAGGGAACAGAGCATCCAGAGCAGAGCTTCCAGAGCAGAGCCACC
CTCCAGTCAGATTCAGTCCGACCTTAGTTGAAACGGACACGGAGTTCAGTCGCCACCGTT
AACTCTTTCACATTGGACGCGAAAAGCGCGTTCGCGAAATTAGTGAGCAAAATTGGAAAG
AGAGCGAGCTTACAAATGAATTAAGCGCCAAAGTGCGGATAGTgatcgaagaatacataa
gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc
atccgacatgtcatnctcttcagaccaatcaaatccatgaagagcatncctgggcataaa
atccaacgggaattgnggagttatcatgatgagctgncgagtcaatcgatacagtcaact
gtctttgacctttggtactactctcttccgatgatgatgtcgcacttattctatgctgtc
tcaatggtagaggcatatcagtctcctncccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE