Detailed Information [104198]
Strain Information
DGRC Number 104198
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}Sxl[NP2426] / FM7c
Genotype w* P{w+mW.hs=GawB}SxlNP2426 / FM7c
Break points/Insertion Site 6F5
Map Viewer
Related Genes CG33070 CG4615
Original Number 2426
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2426

NP line. Received from the National Institute of Genetics.

Also known as LN2-GAL4
Balancer FM7c
Cluster id 197
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression epi stripe
Larval GFP weak
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-05-21
Research papers using this strain
[Please submit your publication]
Brown EB, Rayens E, Rollmann SM.
The Gene CG6767 Affects Olfactory Behavior in Drosophila melanogaster.
Behav Genet (2019) 49(3) 317-326 [PubMed ID = 30710192] [RRC reference]

Rozenfeld E, Lerner H, Parnas M.
Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior.
Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np21655_0807
Strand Minus
Insertion Point 6836504
Chromosome Band X
Flanking Sequence
attttgggnaaaaacccttttttgtatacttcggtaagcttcggctatcgacgggacccc
ttatgttatttcatcatgGGTGAGGAGAGGGCAGCTGCATTTATTTCCTTTTCTCTTCAT
CTCCGCTTCTCGGTGGGTCATTCCCCTTCTTGCTGTTGGCAATGACGTCGCATCGCAACg
atcgaagaatacataagagagaaccgtcgccaaagaanncattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaa
tcgatacagncaactggctttgacctttggtactactctctttcgangatgangncgcac
ttattctatgctggctcaatggtagaggcatatcagtctccactgaagcatnttnttttt
ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE