Detailed Information [104223]
Strain Information
DGRC Number 104223
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Trf4-2[NP2505] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}Trf4-2NP2505 / TM3, Sb1 Ser1
Break points/Insertion Site 96B9
Map Viewer
Related Genes CG11120 CG17462 Doc{}1419
Original Number 2505
Chromosome 3
Comments FlyBase Insertion: P{GawB}Trf4-2[NP2505]

NP line. Received from the National Institute of Genetics.

Also known as P{GawB}NP2505
Balancer TM3 Sb Ser
Cluster id 1631
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Nakamura R, Takeuchi R, Takata K, Shimanouchi K, Abe Y, Kanai Y, Ruike T, Ihara A, Sakaguchi K.
TRF4 is involved in polyadenylation of snRNAs in Drosophila melanogaster.
Mol Cell Biol (2008) 28(21) 6620-31 [PubMed ID = 18765642] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np23655_0807
Strand Plus
Insertion Point 20741832
Chromosome Band 3R
Flanking Sequence
tttttnnnnactntnnttggggtgananagccatttttttgnatacttcggtaagcttcg
gctatcgacgggaccaccttatgttatttcatcatgATTCGCGTTTTACAGATTCCTTCG
TTTCTCGTCCGTATTCTTCTTTCTATCTCCGTCACACTTATATTTTTCTTTCTCTCAATT
CCTTTTTCGCGTAAAGCAATACGCGGGACGCAAAATGTGTGACGAAGCGAATCCATNNAA
GCCGTGGCAGCTTCCCGATGTGGTGTACGGCAATGGGATTCCGGCGCTGTGCCTGCTGCA
CCAGGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggg
gtcccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc
catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg
ccgagtcaatcgatacagtcaactgtctttgacctttgtactactctcttccgatgatga
tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnt
tttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE