Detailed Information [104313]

Strain Information
DGRC Number 104313
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}IP3K2[NP2758]
Genotype w* P{w+mW.hs=GawB}IP3K2NP2758
Break points/Insertion Site 11E11
Map Viewer
Related Genes CG12724 CG1630
Original Number 2758
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2758

NP line. Received from the National Institute of Genetics.

Balancer CyO; TM3 Sb Ser
Cluster id 319
General Information NP_lines
Embryonic Expression scattered cells (SG)
Larval GFP ubiquitous
Larval X-gal epi, gut
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24855_0807
Flanking Sequence
gggnagggntgttngtntttttggnngantaaagganggaaanagagcnntnntnggggc
nncggaaaaccccnggctatngacgggnaccaccttatgttatttcatcatgAGTCGANC
AGTTGAGCTTTTGCTGCgatcgaagaatacataagagagaaccgtcgccaaagaacccat
tattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagacc
aatcaaatccatgaagagcatccctgggcataaaatnngggggnattgtggagttatcat
gatgagctgccgagtcaatcgatacagncaactgtctttgacctttgttactactctctt
ccgatgatgatgtcgcacttattctatgctgnctcaatgttagaggcatatcagtctcca
ctgaagccatnnnaatntgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np60653_0309
Strand Minus
Insertion Point 13051965
Chromosome Band X
Flanking Sequence
gaagcatcgttagtggatgtctcttgccgacgggaccaccttatgttatttcatcatgGG
TCGACTCTGCTCTAAAAAAACGGAACCCAAACGAGCCAAACCGAACCGAACTCGCTGAGA
GCTCCGCCGGCGATGAGCAGCAACAACAGAAGCAGCAGCAGCAACCGCAACAGCAGCAAC
ACGGGAGCAGCATCAGCTTTCATTTACGGGAGTCCTACCAATAAATCCCATCGAAATCCA
GTCCGAAATCCGCGAGCTCAGACTGATAAGGCAGATTAGGCGGATTTGGGGGTGATATAT
GTACATATACACTGGCAAAAATAACGGATTATTTCACAGATAGTACTAACTGCTCACATT
TCATATAATTATGATAAGGTCAAACTACATCATAAACAGTATTGGAACAGATATCTCAAA
AAGNATCTCACCAATATTAAGTAAGNCATTAGCTTCTTAATGCTCACTTTCGNAANATAA
TATCNTTTATCATAAANATTATATTTTGNTGACTTTGGGTACCTTNAAAAACCAAAANTT
TTAAGAATTNAGCTAAAAAATCATTTTTCCAAAGGNTTAAGANTTAAGTCCCTTGGNAAA
CCAGNCCGAATTTTTTGNAGCTAAAAATTGANCCAATGNAATTGNNTTTTTNCCGGGNCC
TTNGGCCAAAATTTCACNGGAAAAAAGAGGGGNNCCCACCTGGGGNCAAAGGNTATTNTN
TGGCTANACTNNCCCGAAGNCCGNGTTAAGNTCCTTCTGGGGNNTGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnn

Library Name / Clone Name np / np70495_0810
Flanking Sequence
gtcaacgtgcactgnanttagtgtatacttncggtaagncttcggctatcgacgggnacc
accttatgttatttcatcatgAGTCGACCAGTTGAGCTTTTGCTGCgatcgaagaataca
taagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaa
gccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcat
aaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaa
ctgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctg
tctcaatgttagaggcatatcagtctccactgaagcatctttnnnttgggnnctactntc
ttncgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctc
cactgaagccatnnnnatctgnnnnncnnnnnnnngnnnnnnnnntnnnnnncnactntn
tnncnnnnnnnannnnnnnntnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnncatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nn


CLOSE