Detailed Information [104355]
 

Strain Information
DGRC Number 104355
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3045
Genotype w*; P{w+mW.hs=GawB}NP3045
Break points/Insertion Site 58A2
Map Viewer
Related Genes CG13492 CG4363
Original Number 3045
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3045

NP line. Received from the National Institute of Genetics.

Cluster id 908
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression head so, tail,
Larval GFP sg, gut
Larval X-gal gut, tr
Adult GFP macrochaete, abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34235_0907
Strand Minus
Insertion Point 16875201
Chromosome Band 2R
Flanking Sequence
tttngtgcactgantttaantgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGGCCGGCTTATCTGGGATAGTTTTTGTTGCTTTTTATGTTAAT
TCCCCTCAATCGGTTATAAATAACGAAGCTTTATCGGCCTTATAGCTATGGCAACAGTAC
CTACAATATAATCGCATTGGTCCCCTAATATAGAGCAATAATCAAACAGCCACGATAGGA
GCCATCGATCGATNAATACATANGAGAGAACCGACGCCAAAGAACCCATTATTGNTGGGG
NNCGTNTTCANGAAGGGCANGCCATCCAACATGTNATNCTGTNTAGACCAATCAAANCCA
TGAAGAGCATCCNTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCC
GAGTCAATCGATACAGTCAACTGNCTNTGACCTTTGTTACTACTCTCTTCCGATGATGAN
GTNGCACTTATTCTATGCTGNCTGAATGTTAGAGGCATATCANTCTCCACTGAAGCCATC
TNAATNTNGGGNNNNNNNNNANNNNNNNCAAGNNAAANNGGNNNNNNGNNNCNTTNGNNN
CNTACNTNNNNTNNNNNAAGGNNGAANGNNNNNACTTAATTGTATGCTGTNNNNAANNGG
NNNGAGGCAATANNANNCNTNCANTGNAGCCNATNNNNNNNNGGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE