Strain Information | |
---|---|
DGRC Number | 104359 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}dve[NP3060] |
Genotype | y* w*; P{w+mW.hs=GawB}dveNP3060 |
Break points/Insertion Site | 58D2 |
Map Viewer | ![]() |
Related Genes | CG3380 dve CG5819 |
Original Number | 3060 |
Chromosome | 2 |
Comments | Balanced by Cy chromosome 18Dec2012MT FlyBase Insertion: P{GawB}NP3060 NP line. Received from the National Institute of Genetics. |
Cluster id | 911 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | a small # of cells (TU) |
Larval GFP | wing pouch (excluded in margin), midgut. |
Larval X-gal | wing pouch, |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2017-11-23 |
Research papers using this strain [Please submit your publication] |
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H. Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development. Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np14245_0727 |
Strand | Plus |
Insertion Point | 17287614 |
Chromosome Band | 2R |
Flanking Sequence | antacttngngtcactnaacctattttatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgGTCAGTCAGGAGCAGGAGCCCAAGGATTCGGCACGCCAT CTGCCGGAGAAACCAGACAGGCGGACAGCCAGACAGCCTGAACGCCTCAACCTCAACGGT TGGCTTGATTTGCGATTGCCGCATTCGCCAAATTCGATACNCTGCCAATCCTGGTGACGC AGTGACGCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgg ggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg ccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatg atgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatn ttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnn |