Detailed Information [104360]
 

Strain Information
DGRC Number 104360
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG8379[NP3061]
Genotype w*; P{w+mW.hs=GawB}CG8379NP3061
Break points/Insertion Site 85B2
Map Viewer
Related Genes pyd CG8379 CG9836
Original Number 3061
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3061

NP line. Received from the National Institute of Genetics.

Cluster id 1392
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression scattered in ecto
Larval GFP sg
Larval X-gal epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Alyagor I, Berkun V, Keren-Shaul H, Marmor-Kollet N, David E, Mayseless O, Issman-Zecharya N, Amit I, Schuldiner O.
Combining Developmental and Perturbation-Seq Uncovers Transcriptional Modules Orchestrating Neuronal Remodeling.
Dev. Cell (2018) 47(1) 38-52.e6 [PubMed ID = 30300589] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34585_0907
Strand Plus
Insertion Point 4650187
Chromosome Band 3R
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgCTATNGNCCATCCACAAATTGNTGCCAACTTCCGATATATTTTTAC
AGCAGCAGACTATGAGTTTCTGAAACTAGTCCCCTAGGTCAATAATATCCACATCCAGTC
ATGACCTCTCGCAAGCGCAGTGGCAGCGGCTCCACCAAGCGGCCCAAGGAGAAGGTTCGC
CCGGAGCACTGGATTTCACGAGCTCCGCCCTCGAAGATTTGTGCTTTGCTTGACTAATTG
GAATTTATTGCAGGTGGTCTATATATATGAGCTGNTGTGCCGGGGCGAGGATCCCAGAAT
ACATAANACAGAACCGTGGCNNAANAACCCATTANTGCTGGGGTCCGTTTTNNGGNAGGG
CCANCCATTCNGCATGTCATACTTTTNAGACCAATCAAATCCATNAAGAGNNCCNTGGGN
CNTTAAATCCAACGGGNATTGNGGAGNTATNATGAAGAGCTGNCCGGNNAATCCAATACA
ANTAACNGNCCTTGACCCTTGATACTACTNTTTTCCNAAGANGAAGGNCNCACTTATTTT
ATGCTGGCTCAATGGTAGANGCATATNANTCTNCACTGAAGCATNNNNNNNNNGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAANNNNNNNNNNNNNNNNNnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnn

CLOSE