Detailed Information [104395]
 

Strain Information
DGRC Number 104395
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}bbc[NP3157]
Genotype y* w*; P{w+mW.hs=GawB}bbcNP3157
Break points/Insertion Site 50A12
Map Viewer
Related Genes cid CG6016 drk
Original Number 3157
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3157

y[*] seems to be fixed. 07May2009 MT
NP line. Received from the National Institute of Genetics.

Cluster id 733
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sg, tr
Larval X-gal fb, gut, mt, oenocyte
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2018-10-15
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14175_0727
Strand Minus
Insertion Point 8558403
Chromosome Band 2R
Flanking Sequence
ctncttnnggcaaaacncttttttatacttcggnaagctccggctatcgacgggaccacc
ttatgttatttcatcatgGTTTGGACACAAACTATGCCAGCGATAAGATAGCGAGGGCGT
CTCGCCACTTTACCCATCCACACACGAACAGCGCGAATTATAAGTAATCGCAATCATTGT
CCGTTTGTCGCCGGTTTATGACGCATTTTTTTTTTTTNTNNTTTNNNNNNANNAANNAAA
NATTTTTTNTTTTTTAGTTTNGGGGGGCCNCGCGCNTNTNNNGCAAAAAAAAAAAGNCCC
NNNCTTTTTGGAAAGGGNNTNNAGGGGNAAAAAANAGANNGAGAACCCNANAGGGGGGGG
GGGGGGNNAATANATAAAANTCCGCTTTTTTTTNCGCNCTTCTTAAANAGAGAGGGGNTA
TNAAAANACCCTCCGCNNNTTTTANAAAAANACNNNNAANGAGGGNGGCGCCNNANNAGN
AGAANNAAAAAAGATNTTTTTNNCAAAAANCCCCCCCCCCCCCCANGAGNGAGAAAGANA
TCNCNTTCNGTGNNATANNCCCCCCCGGGGGGGAAAAAANTTNTTTTTTTATTTTTCCNA
AANNNGNNGGGGGGCCCCCCCCTNNATNNGGGGAGNNCNCCCCTCNTNTTTNNNANNNGA
TANNAAANAAAANNNNCCCNTCCNNNTTTTNATATANTATNNATATTNTTNTGGNGGGCG
GGGCGCGCGCCCCCCCCCCNNNAANNAGANGANAGNNNACNNNNNGGNGAGNGNNNNTNT
TNNNTCTNNCCNCCNCNCNNnanagagnaaagnaaaaaaanaaaaaaaagangnggggng
gcgncgcgccccgccnnnnnnaaanatatttaattattnaaaaaanganagataatnnnn
cctcntggncggggggggggnaggagagnaaaaatanctancttctttntntttat

CLOSE