Detailed Information [104537]
 

Strain Information
DGRC Number 104537
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3550 / TM6, Sb[1] Tb[1]
Genotype w*; P{w+mW.hs=GawB}NP3550 / TM6, Sb1 Tb1
Original Number 3550
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3550

NP line. Received from the National Institute of Genetics.

Balancer TM6 Sb Tb
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression AS (TU)
Larval GFP ubiquitous
Larval X-gal sg, cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Vanrobays E, Jennings BH, Ish-Horowicz D.
Identification and mapping of induced chromosomal deletions using sequence polymorphisms.
BioTechniques (2010) 48(1) 53-60 [PubMed ID = 20078428] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13275_0727
Flanking Sequence
actncttgnggtaaaaacccccctttttgggnacttcggaaagccttcggctatcgacgg
gaccaccttatgttatttcatcatgGATGTGGCGTTCGTTGATGAACCGGCATGCCGCAG
TGTGACCAGACTACATTGGAACTACATCGGGTTGAAGAACTTATTTAAATTTATTTATTT
TACGGACAATTGTCAATATGGAAATATTTTGCTTTAAATTNTTTTTTTAAAAAATATTGA
AATATAAAAATAGTACATACTTACTTCAAAATGCATAAATGGGTAACTAAATTCCTTTGN
TGGTATTTTTCATACCTGTTGNGCGACTACTATCACTCTAATTTGNTTGNTTACAAATTT
CAGCGCGAATTTCGCGACCAAAAACCTAGTGCAAATATTGCCAATGAAATACACTTTAGA
GGGCAGCAATGCAAGAGGGTNCCACATAATTAAACAGCAAAATATATTTGATAACCAAAA
AGAATTTCATTTTTTTAAAGTCATCGGCCAAAGCCGNACAATCGCTGTCCAANGGGGGGC
AAGGGAGATGTTCATCNGNGATCGNAGAANNCNTAAGAGAGGACCCGGCCCCAAAAAAAN
CCCATTTTTGGTNGGGGGNCCCGTTTTCANGGAAGGGCNAAGCCATCCGNACATGGTTAA
TCCTTNTTNAGACCAATCAAAATCCNNGGAAGGNGCNTCCCCGGGGCATTAAAATCCAAC
GGGAATTGGGGGGGTNATCAAGAAGGNGCCNGCCCGGGNCAATCGAACCAGNNAACCGGG
CNTGGACCCTTGGGANCNACnctcttccgaagganganggcgcacttattctatgctggc
ccaangnnagangcatatcagccnccngccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagngn

CLOSE