Detailed Information [104588]

Strain Information
DGRC Number 104588
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}boi[NP4065] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}boiNP4065 w* / FM7c
Break points/Insertion Site 3A3
Map Viewer
Related Genes EG:BACH59J11.2 trol
Original Number 4065
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4065

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 76
General Information NP_lines
Embryonic Expression scattered cells (TU)
Larval GFP sg
Larval X-gal pns?
Adult GFP bodywall. not in appendages.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hartman TR, Ventresca EM, Hopkins A, Zinshteyn D, Singh T, O'Brien JA, Neubert BC, Hartman MG, Schofield HK, Stavrides KP, Talbot DE, Riggs DJ, Pritchard C, O'Reilly AM.
Novel tools for genetic manipulation of follicle stem cells in the Drosophila ovary reveal an integrin-dependent transition from quiescence to proliferation.
Genetics (2015) 199(4) 935-57 [PubMed ID = 25680813] [RRC reference]

Yorimitsu T, Kiritooshi N, Nakagoshi H.
Defective proventriculus specifies the ocellar region in the Drosophila head.
Dev. Biol. (2011) 356(2) 598-607 [PubMed ID = 21722630] [RRC reference]

Wang LH, Huang YT, Tsai YC, Sun YH.
The role of eyg Pax gene in the development of the head vertex in Drosophila.
Dev. Biol. (2010) 337(2) 246-58 [PubMed ID = 19896935] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np27275_0807
Flanking Sequence
ttttttgngcactgaaatttaagttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgATCNNNGAATACNTANGACAGAACNGTCCGCCAAANCAA
CCCATNCTNGCTTGGGGNNCGTTACCAGNNAGGTCNAGCCNTNCGACATGTCATCCTCTT
CANACCAATCAAATNCATGAAGAGCATNCCTGGGCATAAAATNCAACGGCAATTGNGGAG
TTATCATGATGAGCTGCCGAGTNAATCGATACAGNCAACTGTCTTTGACCTTAGTNACTA
CTCTCTTCCGATGATGATGTCGCACTNATTCTATGCTGNCTCAATGNTAGAGGCATATNA
GACNCCANTGAAGNCATNTTTTTNNGGGGAANNANGTNNNACNNATTTTTTGGCTGGNTN
AAAGNNTNNAGGGANNTNANNTTTTCNCTGGANCCATTTATTNNNNNNCNNNNNNNGNNA
ANNGGNNNGGGGGNNNNNNNNNNAGGNNNNNNNANNTNCNNNNGGNNCCNNNNNNNNNGN
NGNNNNNNCNTTNNNCCNNNNNNNNNNAANNNNNNNNTNNNNNTNNNTNNNNNNNANNTT
NNNNTTNNNTNAANANNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNN
TNNNNCCNNNNNTNNTTNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np61313_0309
Strand Plus
Insertion Point 2226043
Chromosome Band X
Flanking Sequence
tttttactgcgcacttatngcaagtnntacgttaagtggatgtctcttgccgacgggnac
caccttatgttatttcatcatgGACCAGATGAACTACTTTCGAGACACTGGCCACTGGCC
ATTGGCCATTTACCGTTGCAAAACTCACCTGTTGACTGAAACCTCGAAGGGCAGCTAAAT
CCTCTATCCAAATCCAATTCCAATCTGCGCCGCTTGTCGCACTCTAAACGAACGGTAAAT
ATTTTGATTAGATTTTGATCCTCTNGCTNGNGGCTTNGGNCACTNGNGGATNATGGAAAC
TATAACTAGAGANTNTNANTNCTCNTAANTAATATAATGAGANACTTTAAACCCCCGGGC
ATGCTAAGGGTTATGNGACAATTCNAACCCTGGNNNATTCTAANGGATTACNNACCNNAN
ANTTCNTNTGCTTTANTCTACCTCTATTGGNAGTNTAANNGGTNAANNGATGTNTNTTGG
CNNTNGNGCCACNCNTANNNTANTNNATTTNGNCCNNNNNNNCNNCNTNNNNNACACTNG
NNNCTGGNCACTGGNCTANNCCNNTNNNAAANNNNNCCNNTGNNGNAANCCNAANGGNNN
NNAAANCTNTTNTNAANCAAANCCNNNNGGNCNNTNGNNCCNNTTNAANNAAAGGNAAAN
TNNNNNNNANNNNANNCTNNNCNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

Image Files
Larval GFP

g1 (->Large)


CLOSE