Detailed Information [104787]
Strain Information
DGRC Number 104787
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}uzip[NP4798] / CyO
Genotype w*; P{w+mW.hs=GawB}uzipNP4798 / CyO
Break points/Insertion Site 60E12
Map Viewer
Related Genes zip CG3441 uzip
Original Number 4798
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4798

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 960
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression restain, scattered cells
Larval GFP cns+pns
Larval X-gal sg, mg, tr
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Terzio?lu Kara E, Kiral FR, Ozturk Colak A, Celik A.
Generation and characterization of inner photoreceptor-specific enhancer-trap lines using a novel piggyBac-Gal4 element in Drosophila.
Arch Insect Biochem Physiol (2020) 104(2) e21675 [PubMed ID = 32285519] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np41475_0907
Strand Minus
Insertion Point 20056188
Chromosome Band 2R
Flanking Sequence
atntttnggtgcactgantttaattgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCCATAGACAAAACGTGAGAGTTTTGCGGAACTAGTCGCG
ACTTCTTCTTATCCTTAACAAAGCACTCGCGACAACAACAATCGATTCTGTTCGTTTGCA
GTTATTTCTTCCGCAAATGCAAATTGAATTCGCTATTGCNNTCTAATTTCGGCACATACA
CACGCATACGCACTCTCGCCACACATACACACGAACACAGAGAAACTGGTCAGCAGGCGA
ATGACGTCATTGCCAAGGATGCTGCGCGCATCTCAAGAACGCTGCCAGAAGTAGCACTTC
ATTTAAGGAACTGTGTTCTTGCTCTTAGTTGGAATCACTCAAGTCCGTTTCCCCAGAATT
AAAAGTTCGCAAGGAGCCCCGCCAGATATTTTATTAAAGTCAATTTAATTGCGACTGGCG
CCAAGCACTCACATCTGGGCTGTGATACTCGGAACTGGACTTACTGATTCAAAGCGCGGG
CCTTTACCCGTTCCCTCGAAAAATTCAAAATTAACTGAAAGTATCCCGCACATTCCGCGC
ATTAACCCAACGGGTTATTTGAAGTTTGGGTTTACCCAAGAACTGGTTTCGAAGAGAGGA
CAGCACGCGAGAACCCCGCAAAACACCAAAAACAAAAAGGGNGGAANGGATTTTTGATGN
TGGCGNGCCGGCCAACTAATGAACCTCCGTNTNTGTCAAAAGGTAAATCGCATATACGAT
CCTTAGCTTGCNCTAATTGGnccatattntaattggaaagngggtgggaacatccttgct
nntctgatttgcagggagngaatcggaaanaattaatctattttnttcggaggntcg

CLOSE