Detailed Information [104910]

Strain Information
DGRC Number 104910
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Arf51F[NP5226] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Arf51FNP5226 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 51F6
Map Viewer
Related Genes mus210 CG8155 Arf51F CG8157
Original Number 5226
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5226

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 777
General Information NP_lines
Lethality lethal
Embryonic Expression weak stripes in stg 14, scattered pattern later. amx?
Larval GFP fb
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Peru Y Colon de Portugal RL, Acevedo SF, Rodan AR, Chang LY, Eaton BA, Rothenfluh A.
Adult neuronal Arf6 controls ethanol-induced behavior with Arfaptin downstream of Rac1 and RhoGAP18B.
J. Neurosci. (2012) 32(49) 17706-13 [PubMed ID = 23223291] [RRC reference]

Acevedo SF, Peru y Colon de Portugal RL, Gonzalez DA, Rodan AR, Rothenfluh A.
S6 Kinase Reflects and Regulates Ethanol-Induced Sedation.
J. Neurosci. (2015) 35(46) 15396-402 [PubMed ID = 26586826] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49235_0912
Strand Minus
Insertion Point 10386578
Chromosome Band 2R
Flanking Sequence
tttttnggggcantgaccttatttttatncttcggtaagctncggctatcgacgggacca
ccttatgttatttcatcatgGGAGCAACGATATCGGATGGTTTTCGGATTCTACGGAATT
TCGCTCGCTCTCTCGCTGCTGCTTGCCTACGTCACAAACACGCCCGTAACACACATACAC
ATGTATACACACCCAAGTCTCCGACGACCGCCGTTACGCACCGCTTTCCAGCCCAATTCG
TTCCACGCCAGCCTGAAATCCGTTAACATGTAGTGCCAAAGTGCGCGGGCCGGGGCATAA
AATGCATTTGCTAGCACACGGCGGCCAAAAAACTATAACTAACAACAACAATTTTGCACT
AATCTTCTTGTATTTATATACACATACACGAAGCANTGTGCCCGTTAGCGCAGAGCGGAA
CAAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattggtggggtcc
gttttcaggaagggcaagccatccgacatgtcatcctctttagaccaatcaaatccatga
agagcatcccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga
gtcaatcgatacagtcaactggtctttgacctttggtactactctcttccgatgatgatg
ncgcacttattctatgctgnctcaatggtagaggcatatcagtctncactgaagccattn
tnttttggnntnntttnntgttcgncttttttcncntcnnnnncctnnnntcccccncnn
ccnttncgnnnnnnnttctccntnctnntncnttttttttttntnntnnnncccgtttnc
cncnnntnntttcttcaannnccnnntttngntctnggcgtntccnctcttttnntccan
ncncnnccannacccnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)


CLOSE