Detailed Information [104917]
 

Strain Information
DGRC Number 104917
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5247 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5247 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 53D1; -; 53D3
Map Viewer
Related Genes CG6301 mir-8
Original Number 5247
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5247

NP line. Received from the National Institute of Genetics.

Also known as mir-8[Gal4]
Balancer CyUW14
Cluster id 808
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression stripe in every seg from stg 11. become uniform later. excluded in head. low in tail earlier.
Larval GFP ubiquitous
Larval X-gal fat body. epidermis. not in discs. (s.g.)
Adult GFP uniform
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Montigny A, Tavormina P, Duboe C, San Clemente H, Aguilar M, Valenti P, Lauressergues D, Combier JP, Plaza S.
Drosophila primary microRNA-8 encodes a microRNA-encoded peptide acting in parallel of miR-8.
Genome Biol (2021) 22(1) 118 [PubMed ID = 33892772] [RRC reference]

Juarez-Carreno S, Vallejo DM, Carranza-Valencia J, Palomino-Schatzlein M, Ramon-Canellas P, Santoro R, de Hartog E, Ferres-Marco D, Romero A, Peterson HP, Ballesta-Illan E, Pineda-Lucena A, Dominguez M, Morante J.
Body-fat sensor triggers ribosome maturation in the steroidogenic gland to initiate sexual maturation in Drosophila.
Cell Rep (2021) 37(2) 109830 [PubMed ID = 34644570] [RRC reference]

Kennell JA, Cadigan KM, Shakhmantsir I, Waldron EJ.
The microRNA miR-8 is a positive regulator of pigmentation and eclosion in Drosophila.
Dev Dyn (2012) 241(1) 161-8 [PubMed ID = 22174085] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49415_0912
Strand Minus
Insertion Point 11894461
Chromosome Band 2R
Flanking Sequence
GTGNTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGGCTGCGGC
GCCGACGAGCTCCGCCGACGGCTGCGCTGCCCGCGGCTAGAGGTGGCAGCGCGGCACGAT
GTTTGCTGCGTGACACGAGCACGCTGCTCAGACCACGTGTGTTTGTGTAAGTAAGTCGCT
TCTATTCTAGAAGTTCAAAAGTCATTGGTTTAGGGAAGTGGTTTCAGTTTGGAAAACTAC
ATTACACTTATGCAATTAATTATGTCATTCAATCTGGGACTGCTAGCAAGTTAAAACAGT
TCAAGCGACTAGACTAAGACTAAGCGTGTTTGCCGCACGCCACCATNTTTAGCCGCGANC
GAAGAATACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGGTGGGGTCCGGTTTCA
GGAAGGGCAAGCCATTCGACATGTNATTCTNTTNAGACCAATCNAATNCNTGAAGAGCCT
TNCCTGGGCATTAAATCCAACGGAATTGGGGAGGTATCATGATGAGCNGCCGAGTTAATC
GATACAGGCAACTGGCTTTGACCTTTGGTACCACCCTTTTTCCGAAGAAAGAAGNGCCCN
CTTTTTTTTNTGNTGGCTCAAAGNTAAAAGGNATATNAATCTTCACTGGAGCCATNNTTT
TTTTTTGGGNNNNNNNNNNNNNNNNNNNNNNCNNNNCCNNNNCCCNNNNNCNCNNNNNCC
CNNNNNNNNNTNNNNNNNNNTNNCNNNNNNNCNNCTCNNTCNCNGNNNNNNNNNNCNNNN
TCNNNNCNNNNNNNNNNNTNnnnttnnncnnnnnnnncgnnnngncccntnnnnnntncc
cnccccnnnnnnnnnncnncntntncntnntttnnnnnnncncnccnnnccncn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

CLOSE