Detailed Information [104937]
 

Strain Information
DGRC Number 104937
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5288 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5288 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 51A3; -; 51A4
Map Viewer
Related Genes CG17389 CG17390
Original Number 5288
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5288

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 758
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression glia? specific 2-3 elongated cells located on nerve that exit CNS. starts in stg 16. PSP, ring gland, head.
Larval GFP maybe a part of thoracic disc. humeral disc. posterior spiracle. (s.g.)
Larval X-gal fat body. not in discs. (s.g.)
Adult GFP weak
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Wu Y, Ren Q, Li H, Guo A.
The GABAergic anterior paired lateral neurons facilitate olfactory reversal learning in Drosophila.
Learn Mem (2012) 19(10) 478-86 [PubMed ID = 22988290] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38405_0907
Strand Minus
Insertion Point 9522179
Chromosome Band 2R
Flanking Sequence
gccttnnttgttacttcggtagcttcggctatcgacgggaccccttatgttatttcatca
tgGTGCCAAAGAGCCCAACGGAGAAAGACTGAGAGAGGGAGAGGGAGAGAGAGAGTGTGA
GGAAGCAGACGGAAGGAGAGGGCGACAACTAGGCGAACTGGTTTTTTCGCCTCTGTGTGC
GTGCCTTTTGGGATTCTNGGCCAACAAATGAGAAGCAACACACAGCGAACGTAATTTAAA
TGGCGCCCCCACCCCACCCCCACTNATACACACACGAACGCGCACGCACACGGGCGAGAG
TGAGAAAGCTTTGTGTGTTTTTTNAGCACCACACACTGNTNTTCCGNANTAAAAGCCGAA
NATNNTGCCTTTCGTTGGCCAAAAACCAAATTGCCCCNCATTTGAGGNGNCCNAAAANAN
AGANGGGCNAATTTTNGCGTATTTTNNGGTTTGGGANNTTGGGGCCCCCCNCCCGAAAAC
ATTTTAACCCTTTTTTTNGGCCACACTTTTNCCCCCCCCTTTCACCTTTGNGTCNTNGGG
CAAAGGGGNCGGNAACCTTGGGGANTNTTTNNANAANNCCAANNTNTGGNTTNTTCNTNN
CCCNTTTTTNTTTGGGNNCNGNGNAANACCCGGNNGNGCGCNTTTTTNCNNNNTCCGGNN
NANATTTTTNTGCGGTTTTTCNNNNTTNNTANNCCCCCCNTGNANANTCACCTNNNTTTT
TTTTTCCCTNTNCCCCTTNNTANACCCCTTTTTTTTNGGNTNGGGGNCCCCTTTTTTNGG
GNNTNGGGGGANCCCCCATTncccnagngggnnntttnttttnnnnnncnntnnnattnn
ggnananggnttnnntttngntttttaanncccatnngnnnnggnttttcttttttnngt
gggngtggggngtntttttncnagagnttttttttctnnncccttttttttttttttttt
ttcgnnnnnttttttcccnttttttttnncctncct

Image Files
Embryo

e1 (->Large)

e10 (->Large)

e11 (->Large)

e12 (->Large)

e13 (->Large)

e14 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

e7 (->Large)

e8 (->Large)

e9 (->Large)
Larval GFP

g1 (->Large)

CLOSE