Detailed Information [104957]
 

Strain Information
DGRC Number 104957
Genotype with FlyBase Link w[1118]; P{w[+mW.hs]=GawB}hth[NP5332] / TM6C, Sb[1]
Genotype w1118; P{w+mW.hs=GawB}hthNP5332 / TM6C, Sb1
Break points/Insertion Site 86C2; ---
Map Viewer
Related Genes hth CG31394 CG40209 CG40214
Original Number 5332
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5332

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:86C
Balancer TM6UW23-1
Cluster id 1430 2079
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression ubiquitous, ammunioscerosa
Larval GFP gut, fb
Larval X-gal VERY IMPORTANT. circle in the most proximal seg of leg and wing discs, and outside of the wing pouch. (s.g.)
Adult GFP head thorax
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Ramaekers A, Claeys A, Kapun M, Mouchel-Vielh E, Potier D, Weinberger S, Grillenzoni N, Dardalhon-Cumenal D, Yan J, Wolf R, Flatt T, Buchner E, Hassan BA.
Altering the Temporal Regulation of One Transcription Factor Drives Evolutionary Trade-Offs between Head Sensory Organs.
Dev. Cell (2019) 50(6) 780-792.e7 [PubMed ID = 31447264] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50135_0912
Strand Plus
Insertion Point 1756869
Chromosome Band U
Flanking Sequence
gtttttttnnnngganttnttgggngngcactgcaatttttttgnntncttcggtnaagg
cttcnggctattcgacgggaccaccttatgttatCTTATTCATGCTGCTACAGAGNGNNT
AATCTTACCTAAATNCTGCGACTGCGCCGCCGTCGACAGCGGCAGAAGAGCAGCGTATAT
ATATATATGTATAAGAGAGAGAGAGAGAGAGCTTATGCGCATATATGGCCAGNGGCCAGC
GTGGGGATGCTGNCTTAGCTTAAAGCATANATGGGTGATNGNANAATACATAANANAGAN
CCGCCGCCAAAGAACCCATTATTGNNGGGGTCCGTTTNNAGGAAGGGCAAGCCATCCGAC
ATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCNTGGNCATAAAATNCAAC
GGAATTGNGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGACAACTGTCTNTGA
CCTTTGNTACTACTCTCTNNCGATGATGATGTCNCACTTATTNTATGCTGTCTCAATGTT
AGAGGCATATCATCTCTCCACTGAAGNCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNGN
NNNNNNNNNNNNNNNNNNCNNNNNNNNNGNNTNNNNACCNNNNNNNNTNCNNTNNNNCNN
NNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGNNNNNNNNNNNNNNNN
NNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

Library Name / Clone Name np / np68163_0309
Strand Plus
Insertion Point 6364433
Chromosome Band 3R
Flanking Sequence
atnttttcntgcgccnttaacngcagtcatacgttaatggnagtctcttgccgnacgggc
accaccttatgttatttcatNCATGCTGTAGNGGANNNAGCNGGCAGAAGCNGTATNGTA
NTGCTNGAGNGGATAAGTANGAAACAAAAANCGNGGCCTGACGGNTGNNCCNNACTGCNA
GGAAAACACGTNNTCNCAATTGGTGGNNNNTATNGGTNCNTTACNNCTGATANCCCAAAT
TGCATTGACATTTCCATAATGNGCAGTCTNNNATTCAGGTTTTTGCCCCNNACTCTTTTT
TCTAGNCTANANGTGTAANNATNCACATGCACNNAATGAATTATTATGTAATTGAAACCT
TTACGGTCGCAGCTNTGCCACGATGGCCGNAAGGAGGCGCTGCTGCAGCTGCTTTACGAG
CACAGAGCAAAAAACANCAGAGCAGTTATCTATTTTGTTGCACAGTTTTTGTAGTTTTGT
TGGCATTTTCCGCTGCCGTTTTCANAGCATTTTCCAGTTCTTTTTTTTCGCANAGGAATT
TTGTTGTTTGCTTTTGTTTTAATTAAANGAAAAAGCTTTTCGCGCATAGTTATGAAAAAA
TGGCTGCCAAAAAGGGGGAATATTCCATATACATATNTGTGTGTAAAGAGCATGAAGCCC
GGTTNTTAATGCATNAAAACACNACTAANTGGTTTNTAGCCGGGGCTTCNGAAAGCAAGG
GCCTNAAAGNGTTTTCNCTCGTTTTTNAATAAAAATCCAAAGCCCCCCCCCNAACNAGAC
CTNGNAACTAAAGCCTATGGaanctccggtnctttnanccntgngncnncaagtttnggc
nnaaattntttgggancctnnactnnnnnnccntncgtctttcccccccnnnnnntntta
nntcnactnnatnnnnnnccaccnnccancntnnnncgnccccnnnnngcnntncgtnta
tcca

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

CLOSE