Strain Information | |
---|---|
DGRC Number | 104990 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP5399 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | y* w*; P{w+mW.hs=GawB}NP5399 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 78A1 |
Map Viewer | ![]() |
Related Genes | fng CG10586 |
Original Number | 5399 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP5399 NP line. Received from the National Institute of Genetics. |
Balancer | TM6UW23-1 |
Cluster id | 2011 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | muscle (mesoderom from st 11). psp |
Larval GFP | tr pit associated cells. tr hb in young larva. tr node. |
Larval X-gal | dorsal half of the wing and haltere discs (fng like pattern). multi-circles in the leg disc. |
Adult GFP | distal leg (tarsas) ventral thorax, hinge. not very indicative of disc expression. ubiquitous in yound adult. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Taniguchi K, Kokuryo A, Imano T, Minami R, Nakagoshi H, Adachi-Yamada T. Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory gland cells. BMC Dev Biol (2014) 14 46 [PubMed ID = 25527079] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np50745_0912 |
Strand | Minus |
Insertion Point | 20867004 |
Chromosome Band | 3L |
Flanking Sequence | gngcactgaatttaagtgtatacttcggtaaggcttcggctatcgacgggaccaccttat gttatttcatcatgGCACAAGCTAAAGAGAGAGGATGAGAGCGAGCGCgatcgaagaata cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggc aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc tgtctcaatgttagaggcatatcagtctccactgagccatcttntnnttgggnnnnnnnn nnnnnannnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnntnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnntannnnnttn natnnnaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |