Strain Information | |
---|---|
DGRC Number | 105013 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}ppl[NP5440] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | y* w*; P{w+mW.hs=GawB}pplNP5440 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 78C4 |
Map Viewer | ![]() |
Related Genes | CG12974 ppl AcCoAS |
Original Number | 5440 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP5440 NP line. Received from the National Institute of Genetics. |
Balancer | TM6UW23-1 |
Cluster id | 2018 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | yolk |
Larval GFP | fat body. |
Larval X-gal | fat body. nidgut. not in discs. (s.g.) |
Adult GFP | humerus. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Yan Y, Wang H, Hu M, Jiang L, Wang Y, Liu P, Liang X, Liu J, Li C, Lindstrom-Battle A, Lam SM, Shui G, Deng WM, Jiao R. HDAC6 Suppresses Age-Dependent Ectopic Fat Accumulation by Maintaining the Proteostasis of PLIN2 in Drosophila. Dev Cell (2017) 43(1) 99-111.e5 [PubMed ID = 28966044] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np47365_0912 |
Strand | Minus |
Insertion Point | 21198773 |
Chromosome Band | 3L |
Flanking Sequence | gtcaaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca ccttatgttatttcatcatgCTCGGGTCAACAAAAGTTCACGAATTATATTCTGGATTGT GATAAGCCGGGCAATATTCGACTTTCATCCCGATTGCCGGGCATTAAACGTAGCGTGTGT GTTTTCAAATCGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattg ttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatca aatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatga gctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgat gatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactngn tctnnttnnnnggggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
Image Files | ||
---|---|---|
Adult |
|