Detailed Information [105080]
 

Strain Information
DGRC Number 105080
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP6024 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP6024 / FM7c
Break points/Insertion Site 3C1
Map Viewer
Related Genes EG:BACR43E12.1 w
Original Number 6024
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6024

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 91
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression ch subset+other PNS cells? (TU)
Larval GFP sg, DT, mouth.
Larval X-gal sg, mt.
Adult GFP eye disc but not antennal disc derivatives. humerous, abd.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hamid R, Hajirnis N, Kushwaha S, Saleem S, Kumar V, Mishra RK.
Drosophila Choline transporter non-canonically regulates pupal eclosion and NMJ integrity through a neuronal subset of mushroom body.
Dev. Biol. (2019) 446(1) 80-93 [PubMed ID = 30529058] [RRC reference]

Groschner LN, Chan Wah Hak L, Bogacz R, DasGupta S, Miesenbock G.
Dendritic Integration of Sensory Evidence in Perceptual Decision-Making.
Cell (2018) 173(4) 894-905.e13 [PubMed ID = 29706545] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42245_0912
Strand Minus
Insertion Point 2553591
Chromosome Band X
Flanking Sequence
acttntttnggggngnnnnnccatttttttgggtacttcggaaagcttcggctatcgacg
ggaccaccttttgttatttcatcatgGGTNGGCTATTCCTNTGNNNGAATNANGNNAGGC
NGCGGTTGNTAGCGCAACGANCGCGGNCGAANAAACAGCGCCCCTACANAACANANNGCG
NAATTCATATNAGAGAACCGNNGCCAANNNACCCATTATNGTTGGNNGNCNAAACAANNA
AGGGCAGGNNATCCANCNTGTCATNCTGTTCAGACCANNCANATCCANGNAGAGCATNCC
TGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGANGAGCTGCCGAGTCAATCNATA
CAGTCAACTGNCNTTGACCTTNGCTACTACTCTNTTNCGANGATGATGNCNCACTTATTC
TATGCTGTCTCAATGGNAGAGGCATATCAAGTCTCCACTGAAGCCNATCTTATTCTGTAA
ACACAAAGTGCTGTGCCAAAACTCCTCTCGCTTCTTATTTTTGCTTGGTTTTTGAGTGAT
NGGGGTGGNGATTGGTTTTGGGTGGGNAAGNAGGGGNNGGGGNNAAANNNNNNGGNNNNG
GNCCNNGAGGNTNNNNNNNCCNNNNNNNNNNNNNNNNNGNNNNGNNCCNNNNNNNGNNGN
NNNNNNNGNTNNGGGNGGGNNNCNNNNCNNCCNGNNNNNNTNNNNNCCNNCNNNNNNNNN
NNNNNNTTNNNGNNNTNNNNNNNNNNNNNNNNGNNNNNTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE